Incidental Mutation 'R0501:Mbp'
ID47166
Institutional Source Beutler Lab
Gene Symbol Mbp
Ensembl Gene ENSMUSG00000041607
Gene Namemyelin basic protein
Synonymsgolli-mbp, Hmbpr
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location82475146-82585637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82575197 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 100 (S100F)
Ref Sequence ENSEMBL: ENSMUSP00000099876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047865] [ENSMUST00000062446] [ENSMUST00000075372] [ENSMUST00000080658] [ENSMUST00000102812] [ENSMUST00000114674] [ENSMUST00000132369] [ENSMUST00000143506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047865
AA Change: S233F

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046185
Gene: ENSMUSG00000041607
AA Change: S233F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 147 241 2.7e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062446
AA Change: S126F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053495
Gene: ENSMUSG00000041607
AA Change: S126F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 84 6.7e-25 PFAM
Pfam:Myelin_MBP 79 195 6.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075372
AA Change: S100F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074836
Gene: ENSMUSG00000041607
AA Change: S100F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 158 8.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080658
AA Change: S126F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079488
Gene: ENSMUSG00000041607
AA Change: S126F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 85 4.1e-25 PFAM
Pfam:Myelin_MBP 81 154 3.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102812
AA Change: S100F

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099876
Gene: ENSMUSG00000041607
AA Change: S100F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 169 1.7e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114674
AA Change: S126F

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110322
Gene: ENSMUSG00000041607
AA Change: S126F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 85 6.3e-25 PFAM
Pfam:Myelin_MBP 79 184 1.3e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000123251
AA Change: S142F
SMART Domains Protein: ENSMUSP00000121855
Gene: ENSMUSG00000041607
AA Change: S142F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 31 212 1.4e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132369
AA Change: S99F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114230
Gene: ENSMUSG00000041607
AA Change: S99F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 13 157 5.2e-45 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133193
AA Change: S121F
SMART Domains Protein: ENSMUSP00000116019
Gene: ENSMUSG00000041607
AA Change: S121F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 36 150 4.6e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000142850
AA Change: S123F
SMART Domains Protein: ENSMUSP00000115082
Gene: ENSMUSG00000041607
AA Change: S123F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 38 193 7.9e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150952
Predicted Effect unknown
Transcript: ENSMUST00000152071
AA Change: S162F
SMART Domains Protein: ENSMUSP00000115409
Gene: ENSMUSG00000041607
AA Change: S162F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 51 191 2.7e-47 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000153478
AA Change: S137F
SMART Domains Protein: ENSMUSP00000114630
Gene: ENSMUSG00000041607
AA Change: S137F

DomainStartEndE-ValueType
Pfam:Myelin_MBP 26 196 6.2e-63 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by the classic Mbp gene is a major constituent of the myelin sheath of oligodendrocytes and Schwann cells in the nervous system. However, Mbp-related transcripts are also present in the bone marrow and the immune system. These mRNAs arise from the long Mbp gene (otherwise called "Golli-Mbp") that contains 3 additional exons located upstream of the classic Mbp exons. Alternative splicing from the Golli and the Mbp transcription start sites gives rise to 2 sets of Mbp-related transcripts and gene products. The Golli mRNAs contain 3 exons unique to Golli-Mbp, spliced in-frame to 1 or more Mbp exons. They encode hybrid proteins that have N-terminal Golli aa sequence linked to Mbp aa sequence. The second family of transcripts contain only Mbp exons and produce the well characterized myelin basic proteins. This complex gene structure is conserved among species suggesting that the Mbp transcription unit is an integral part of the Golli transcription unit and that this arrangement is important for the function and/or regulation of these genes. Mutation of the Mbp gene is associated with the 'shiverer' and 'myelin deficient' phenotypes in mouse. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered myelination, oligodendrocytes, Ca2+ responses, and visual-evoked potentials. Spontaneous mutations cause dymyelination, tremors and ataxia, and may alter survival, susceptibility to seizures, viral infection and EAE, and hearing or vestibular function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Mbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Mbp APN 18 82554545 missense probably damaging 1.00
IGL02667:Mbp APN 18 82554615 missense probably damaging 1.00
R0628:Mbp UTSW 18 82554617 missense probably damaging 1.00
R0883:Mbp UTSW 18 82572870 missense probably damaging 1.00
R1791:Mbp UTSW 18 82554349 missense probably benign 0.00
R1843:Mbp UTSW 18 82584122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGATGTGCCATTTCCAGCCCC -3'
(R):5'- AGCTTCAAGGCCAGGACGTGAATC -3'

Sequencing Primer
(F):5'- ATTTCCAGCCCCAGGAAGG -3'
(R):5'- AGGACGTGAATCCCAGCTC -3'
Posted On2013-06-12