Incidental Mutation 'R5975:Cul5'
ID471693
Institutional Source Beutler Lab
Gene Symbol Cul5
Ensembl Gene ENSMUSG00000032030
Gene Namecullin 5
SynonymsVACM-1, C030032G03Rik, C330021I08Rik, 8430423K24Rik, 4921514I20Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5975 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53614582-53670014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53622793 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 680 (R680G)
Ref Sequence ENSEMBL: ENSMUSP00000133144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034529] [ENSMUST00000120122] [ENSMUST00000166367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034529
AA Change: R707G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034529
Gene: ENSMUSG00000032030
AA Change: R707G

DomainStartEndE-ValueType
PDB:2WZK|A 76 461 N/A PDB
SCOP:d1ldja2 91 459 1e-109 SMART
CULLIN 510 661 1.12e-80 SMART
Cullin_Nedd8 782 849 5.12e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120122
AA Change: R503G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113490
Gene: ENSMUSG00000032030
AA Change: R503G

DomainStartEndE-ValueType
PDB:4JGH|D 1 258 N/A PDB
SCOP:d1ldja2 5 255 2e-75 SMART
CULLIN 306 457 1.12e-80 SMART
Cullin_Nedd8 578 645 5.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141803
Predicted Effect probably damaging
Transcript: ENSMUST00000166367
AA Change: R680G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133144
Gene: ENSMUSG00000032030
AA Change: R680G

DomainStartEndE-ValueType
PDB:2WZK|A 76 434 N/A PDB
SCOP:d1ldja2 91 432 9e-99 SMART
CULLIN 483 634 1.12e-80 SMART
Cullin_Nedd8 755 822 5.12e-17 SMART
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality. Mice heterozygous for a null allele exhibit decreased susceptibility to LPS-induced lung injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Cul5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Cul5 APN 9 53635007 missense probably damaging 1.00
IGL02043:Cul5 APN 9 53658673 missense probably benign 0.26
IGL02145:Cul5 APN 9 53635075 splice site probably benign
IGL02261:Cul5 APN 9 53635037 missense probably damaging 1.00
IGL02281:Cul5 APN 9 53635049 missense possibly damaging 0.87
IGL02639:Cul5 APN 9 53655342 missense possibly damaging 0.89
IGL02697:Cul5 APN 9 53655331 missense probably benign
IGL02752:Cul5 APN 9 53634978 missense probably damaging 0.98
IGL03017:Cul5 APN 9 53644485 critical splice donor site probably null
IGL03031:Cul5 APN 9 53642675 splice site probably benign
IGL03196:Cul5 APN 9 53625880 missense probably damaging 0.99
R0142:Cul5 UTSW 9 53635050 missense probably damaging 0.98
R0415:Cul5 UTSW 9 53667070 missense probably benign 0.00
R1619:Cul5 UTSW 9 53658593 missense probably benign 0.00
R1675:Cul5 UTSW 9 53646683 missense probably benign 0.00
R2031:Cul5 UTSW 9 53667180 missense probably benign
R2059:Cul5 UTSW 9 53667156 missense probably damaging 0.98
R3401:Cul5 UTSW 9 53621212 missense probably benign 0.02
R3427:Cul5 UTSW 9 53617890 missense probably benign
R3701:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3702:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3815:Cul5 UTSW 9 53622943 missense probably benign 0.31
R3848:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3849:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3850:Cul5 UTSW 9 53617986 missense probably benign 0.34
R4592:Cul5 UTSW 9 53633727 splice site probably benign
R4690:Cul5 UTSW 9 53622871 missense probably damaging 1.00
R5154:Cul5 UTSW 9 53625867 missense probably damaging 1.00
R5173:Cul5 UTSW 9 53642734 missense probably benign
R5645:Cul5 UTSW 9 53622943 missense probably benign 0.17
R5868:Cul5 UTSW 9 53658673 missense probably benign 0.26
R6251:Cul5 UTSW 9 53646794 missense probably benign 0.40
R6284:Cul5 UTSW 9 53623735 missense probably damaging 1.00
R6415:Cul5 UTSW 9 53646683 missense probably benign 0.00
R7178:Cul5 UTSW 9 53644526 missense probably benign 0.01
X0018:Cul5 UTSW 9 53622929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTCCACTTTGGCAATTAGC -3'
(R):5'- AGGTATTGGAGTAAGCTTCATGAAG -3'

Sequencing Primer
(F):5'- TGTTGAAAGTCATATTTCGAGTGTC -3'
(R):5'- TTGGAGTAAGCTTCATGAAGAAATG -3'
Posted On2017-03-31