Incidental Mutation 'R5975:Ints2'
ID471706
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5975 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86226748 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 716 (I716N)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018212
AA Change: I716N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: I716N

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108039
AA Change: I716N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: I716N

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000134828
AA Change: I29N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146421
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGTATAGGATTCCAGTCTGCCC -3'
(R):5'- ACAGCAAGTTTCCTTAACTCCC -3'

Sequencing Primer
(F):5'- CAGCCCCTCTGTACAGCAGTAG -3'
(R):5'- CTTAACTCCCGATGCTAGTGGG -3'
Posted On2017-03-31