Incidental Mutation 'R5976:Arih2'
List |< first << previous [record 64 of 958] next >> last >|
ID471776
Institutional Source Beutler Lab
Gene Symbol Arih2
Ensembl Gene ENSMUSG00000064145
Gene Nameariadne RBR E3 ubiquitin protein ligase 2
SynonymsTRIAD1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5976 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108602942-108649386 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 108607973 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 54 (*54R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013338] [ENSMUST00000193190] [ENSMUST00000193197] [ENSMUST00000193552]
Predicted Effect probably damaging
Transcript: ENSMUST00000013338
AA Change: M397K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013338
Gene: ENSMUSG00000064145
AA Change: M397K

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 1.21e-1 SMART
IBR 207 269 7.29e-23 SMART
ZnF_C2HC 255 271 2.03e0 SMART
IBR 277 339 1.81e-9 SMART
RING 299 339 5.86e-1 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192853
Predicted Effect probably benign
Transcript: ENSMUST00000193190
SMART Domains Protein: ENSMUSP00000141914
Gene: ENSMUSG00000064145

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 5.7e-4 SMART
IBR 207 269 2.5e-25 SMART
ZnF_C2HC 255 271 8.4e-3 SMART
Blast:IBR 277 317 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193197
SMART Domains Protein: ENSMUSP00000141911
Gene: ENSMUSG00000064145

DomainStartEndE-ValueType
IBR 1 36 1.5e-3 SMART
ZnF_C2HC 22 38 8.4e-3 SMART
Blast:IBR 44 79 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193923
Predicted Effect probably null
Transcript: ENSMUST00000194073
AA Change: *54R
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that polyubiquitinates some proteins, tagging them for degradation. The encoded protein upregulates p53 in some cancer cells and may inhibit myelopoiesis. Several transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been determined yet. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene causes altered dendritic cell physiology, enhanced liver apoptosis, and complete fetal lethality that is partially modified by genetic background. On a mixed genetic background, mice that survive past weaning succumb to a severe multiorgan inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,284,129 A1697T probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Ankrd26 A T 6: 118,517,894 probably null Het
AW146154 T G 7: 41,480,297 K465T probably damaging Het
Bend3 A G 10: 43,510,544 Y311C probably benign Het
Ccdc110 A T 8: 45,943,499 Y809F possibly damaging Het
Ccnh C T 13: 85,190,863 P76L probably damaging Het
Chaf1a T A 17: 56,064,115 C667S probably damaging Het
Clca3a1 A T 3: 144,746,875 Y616N probably damaging Het
Cldn4 A G 5: 134,946,556 C64R probably damaging Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Dclk2 C A 3: 86,787,225 R752L possibly damaging Het
Dzank1 C A 2: 144,501,489 G318W probably damaging Het
Edem1 T A 6: 108,842,962 I236K probably damaging Het
Eif4e1b T C 13: 54,784,822 F75L probably damaging Het
Elmo3 A G 8: 105,307,647 Y266C probably damaging Het
Enpep A G 3: 129,299,124 S509P probably damaging Het
Exoc8 A G 8: 124,896,653 M325T probably benign Het
Fah A G 7: 84,594,741 M270T probably benign Het
Gabbr1 T C 17: 37,067,862 L532P probably damaging Het
Gm10770 T A 2: 150,179,400 K66* probably null Het
Gprc5c A T 11: 114,864,487 Q330L possibly damaging Het
Grin3a T A 4: 49,792,602 H377L probably damaging Het
Hipk3 T C 2: 104,471,184 E221G probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Ighv1-7 T A 12: 114,538,759 E29D probably benign Het
Ing3 T A 6: 21,971,174 S326T probably benign Het
Ipo7 T C 7: 110,048,807 L632P probably damaging Het
Kdm6b A G 11: 69,403,788 probably null Het
Kif21a T G 15: 90,935,812 D1583A probably damaging Het
Lama2 C T 10: 27,190,676 V1070I probably benign Het
Lrp1 A T 10: 127,583,901 S946R probably damaging Het
Lrrc37a A G 11: 103,499,071 S1843P possibly damaging Het
Ltbp1 T C 17: 75,290,083 Y517H probably damaging Het
Map2k4 T A 11: 65,709,952 N51I probably benign Het
Mfsd2b G T 12: 4,866,522 A216D probably damaging Het
Nbea T C 3: 55,853,847 T2025A probably benign Het
Neb A G 2: 52,216,916 V4162A possibly damaging Het
Nr3c1 A T 18: 39,421,549 F599I probably damaging Het
Nsun2 T G 13: 69,623,152 probably null Het
Olfr479 T A 7: 108,055,798 M272K possibly damaging Het
Olfr884 G T 9: 38,047,701 V160F possibly damaging Het
Otoa T A 7: 121,127,713 W524R probably benign Het
Paip1 T A 13: 119,456,997 D182E probably damaging Het
Pde1a G A 2: 79,868,242 Q415* probably null Het
Pfkfb2 T A 1: 130,708,079 K72* probably null Het
Pigg A G 5: 108,332,191 E444G probably null Het
Plec T C 15: 76,189,037 Y669C probably damaging Het
Ptp4a3 T C 15: 73,756,036 V94A possibly damaging Het
Ptprg A G 14: 12,211,625 E969G probably damaging Het
R3hcc1l T A 19: 42,563,350 V262E probably benign Het
Ranbp3l T G 15: 9,002,093 F65C possibly damaging Het
Rbm19 T A 5: 120,140,307 S718R probably benign Het
Recql4 C A 15: 76,709,424 R162L probably benign Het
Rest T C 5: 77,268,272 L111P probably benign Het
Rgma T C 7: 73,409,468 S13P probably damaging Het
Rogdi T A 16: 5,013,311 I31F probably benign Het
Serpinb9e T A 13: 33,255,129 D179E probably benign Het
Slc1a5 T C 7: 16,795,882 C409R probably damaging Het
Slc25a38 A G 9: 120,116,547 T38A probably damaging Het
Spag17 C T 3: 100,095,791 Q1897* probably null Het
St7 C A 6: 17,694,222 A4E possibly damaging Het
Tbcel T A 9: 42,439,203 I263F possibly damaging Het
Tmtc3 A G 10: 100,476,672 V103A probably benign Het
Tnc G A 4: 64,018,166 P178S probably benign Het
Vwf A G 6: 125,603,463 D558G unknown Het
Zfp541 A G 7: 16,076,419 K127R probably benign Het
Other mutations in Arih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Arih2 APN 9 108605410 missense probably damaging 1.00
IGL03213:Arih2 APN 9 108607347 missense probably damaging 1.00
R0009:Arih2 UTSW 9 108611727 missense probably damaging 1.00
R0009:Arih2 UTSW 9 108611727 missense probably damaging 1.00
R0314:Arih2 UTSW 9 108608679 missense probably damaging 1.00
R0413:Arih2 UTSW 9 108616717 missense probably damaging 0.98
R0450:Arih2 UTSW 9 108605092 missense possibly damaging 0.57
R0469:Arih2 UTSW 9 108605092 missense possibly damaging 0.57
R0865:Arih2 UTSW 9 108649300 utr 5 prime probably benign
R2099:Arih2 UTSW 9 108616738 missense probably damaging 1.00
R2913:Arih2 UTSW 9 108644076 missense probably damaging 1.00
R4383:Arih2 UTSW 9 108644277 start codon destroyed probably benign 0.41
R4636:Arih2 UTSW 9 108613814 missense probably damaging 1.00
R5033:Arih2 UTSW 9 108611660 unclassified probably benign
R5562:Arih2 UTSW 9 108607347 missense probably damaging 1.00
R6248:Arih2 UTSW 9 108611642 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TATCTGCAGCATAGCGAAACG -3'
(R):5'- ATAGAGCAATCTGTGGGCCTG -3'

Sequencing Primer
(F):5'- ATAGCGAAACGTGGCCC -3'
(R):5'- AATCTGTGGGCCTGGCTAC -3'
Posted On2017-03-31