Incidental Mutation 'R5976:2610507B11Rik'
ID471784
Institutional Source Beutler Lab
Gene Symbol 2610507B11Rik
Ensembl Gene ENSMUSG00000010277
Gene NameRIKEN cDNA 2610507B11 gene
SynonymsD11Bhm178e, D11Bhm179e, E1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5976 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78261752-78290623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78284129 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1697 (A1697T)
Ref Sequence ENSEMBL: ENSMUSP00000010421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010421]
Predicted Effect probably benign
Transcript: ENSMUST00000010421
AA Change: A1697T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277
AA Change: A1697T

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:Fmp27 26 475 1.6e-45 PFAM
Pfam:Fmp27 446 674 3.2e-24 PFAM
low complexity region 719 734 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Fmp27_GFWDK 1028 1160 3.01e-61 SMART
low complexity region 1415 1421 N/A INTRINSIC
low complexity region 1690 1701 N/A INTRINSIC
Pfam:Apt1 1703 2176 2.4e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147432
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar T C 1: 72,643,291 T1154A probably benign Het
Ankrd26 A T 6: 118,517,894 probably null Het
Arih2 A T 9: 108,607,973 *54R probably null Het
AW146154 T G 7: 41,480,297 K465T probably damaging Het
Bend3 A G 10: 43,510,544 Y311C probably benign Het
Ccdc110 A T 8: 45,943,499 Y809F possibly damaging Het
Ccnh C T 13: 85,190,863 P76L probably damaging Het
Chaf1a T A 17: 56,064,115 C667S probably damaging Het
Clca3a1 A T 3: 144,746,875 Y616N probably damaging Het
Cldn4 A G 5: 134,946,556 C64R probably damaging Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Dclk2 C A 3: 86,787,225 R752L possibly damaging Het
Dzank1 C A 2: 144,501,489 G318W probably damaging Het
Edem1 T A 6: 108,842,962 I236K probably damaging Het
Eif4e1b T C 13: 54,784,822 F75L probably damaging Het
Elmo3 A G 8: 105,307,647 Y266C probably damaging Het
Enpep A G 3: 129,299,124 S509P probably damaging Het
Exoc8 A G 8: 124,896,653 M325T probably benign Het
Fah A G 7: 84,594,741 M270T probably benign Het
Gabbr1 T C 17: 37,067,862 L532P probably damaging Het
Gm10770 T A 2: 150,179,400 K66* probably null Het
Gprc5c A T 11: 114,864,487 Q330L possibly damaging Het
Grin3a T A 4: 49,792,602 H377L probably damaging Het
Hipk3 T C 2: 104,471,184 E221G probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Ighv1-7 T A 12: 114,538,759 E29D probably benign Het
Ing3 T A 6: 21,971,174 S326T probably benign Het
Ipo7 T C 7: 110,048,807 L632P probably damaging Het
Kdm6b A G 11: 69,403,788 probably null Het
Kif21a T G 15: 90,935,812 D1583A probably damaging Het
Lama2 C T 10: 27,190,676 V1070I probably benign Het
Lrp1 A T 10: 127,583,901 S946R probably damaging Het
Lrrc37a A G 11: 103,499,071 S1843P possibly damaging Het
Ltbp1 T C 17: 75,290,083 Y517H probably damaging Het
Map2k4 T A 11: 65,709,952 N51I probably benign Het
Mfsd2b G T 12: 4,866,522 A216D probably damaging Het
Nbea T C 3: 55,853,847 T2025A probably benign Het
Neb A G 2: 52,216,916 V4162A possibly damaging Het
Nr3c1 A T 18: 39,421,549 F599I probably damaging Het
Nsun2 T G 13: 69,623,152 probably null Het
Olfr479 T A 7: 108,055,798 M272K possibly damaging Het
Olfr884 G T 9: 38,047,701 V160F possibly damaging Het
Otoa T A 7: 121,127,713 W524R probably benign Het
Paip1 T A 13: 119,456,997 D182E probably damaging Het
Pde1a G A 2: 79,868,242 Q415* probably null Het
Pfkfb2 T A 1: 130,708,079 K72* probably null Het
Pigg A G 5: 108,332,191 E444G probably null Het
Plec T C 15: 76,189,037 Y669C probably damaging Het
Ptp4a3 T C 15: 73,756,036 V94A possibly damaging Het
Ptprg A G 14: 12,211,625 E969G probably damaging Het
R3hcc1l T A 19: 42,563,350 V262E probably benign Het
Ranbp3l T G 15: 9,002,093 F65C possibly damaging Het
Rbm19 T A 5: 120,140,307 S718R probably benign Het
Recql4 C A 15: 76,709,424 R162L probably benign Het
Rest T C 5: 77,268,272 L111P probably benign Het
Rgma T C 7: 73,409,468 S13P probably damaging Het
Rogdi T A 16: 5,013,311 I31F probably benign Het
Serpinb9e T A 13: 33,255,129 D179E probably benign Het
Slc1a5 T C 7: 16,795,882 C409R probably damaging Het
Slc25a38 A G 9: 120,116,547 T38A probably damaging Het
Spag17 C T 3: 100,095,791 Q1897* probably null Het
St7 C A 6: 17,694,222 A4E possibly damaging Het
Tbcel T A 9: 42,439,203 I263F possibly damaging Het
Tmtc3 A G 10: 100,476,672 V103A probably benign Het
Tnc G A 4: 64,018,166 P178S probably benign Het
Vwf A G 6: 125,603,463 D558G unknown Het
Zfp541 A G 7: 16,076,419 K127R probably benign Het
Other mutations in 2610507B11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:2610507B11Rik APN 11 78269574 missense possibly damaging 0.55
IGL00497:2610507B11Rik APN 11 78272933 missense probably damaging 1.00
IGL00797:2610507B11Rik APN 11 78273150 missense probably benign 0.07
IGL01695:2610507B11Rik APN 11 78265193 missense probably benign 0.03
IGL02055:2610507B11Rik APN 11 78286631 missense probably damaging 1.00
IGL02066:2610507B11Rik APN 11 78273232 missense probably damaging 1.00
IGL02231:2610507B11Rik APN 11 78279896 missense probably benign
IGL02282:2610507B11Rik APN 11 78284228 missense probably benign 0.22
IGL02293:2610507B11Rik APN 11 78271910 missense probably damaging 1.00
IGL02336:2610507B11Rik APN 11 78289032 missense probably damaging 1.00
IGL02528:2610507B11Rik APN 11 78271976 missense possibly damaging 0.93
IGL03231:2610507B11Rik APN 11 78268702 missense probably benign 0.02
R0003:2610507B11Rik UTSW 11 78286578 missense possibly damaging 0.66
R0197:2610507B11Rik UTSW 11 78269704 unclassified probably benign
R0244:2610507B11Rik UTSW 11 78286491 unclassified probably null
R0281:2610507B11Rik UTSW 11 78271924 missense possibly damaging 0.88
R0396:2610507B11Rik UTSW 11 78268377 missense possibly damaging 0.93
R0624:2610507B11Rik UTSW 11 78268457 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78287987 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78277212 nonsense probably null
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1443:2610507B11Rik UTSW 11 78262798 missense probably damaging 1.00
R1485:2610507B11Rik UTSW 11 78285580 missense probably damaging 1.00
R1500:2610507B11Rik UTSW 11 78284132 missense possibly damaging 0.46
R1537:2610507B11Rik UTSW 11 78289343 missense probably damaging 1.00
R1543:2610507B11Rik UTSW 11 78275174 missense probably benign 0.44
R1702:2610507B11Rik UTSW 11 78289028 missense probably damaging 1.00
R1804:2610507B11Rik UTSW 11 78273469 missense probably damaging 1.00
R1835:2610507B11Rik UTSW 11 78287750 missense probably damaging 0.97
R1852:2610507B11Rik UTSW 11 78268473 missense probably damaging 1.00
R1861:2610507B11Rik UTSW 11 78287929 unclassified probably benign
R1986:2610507B11Rik UTSW 11 78274612 missense probably damaging 1.00
R1987:2610507B11Rik UTSW 11 78268167 missense probably damaging 1.00
R2061:2610507B11Rik UTSW 11 78268749 nonsense probably null
R2113:2610507B11Rik UTSW 11 78268772 missense probably benign 0.02
R3692:2610507B11Rik UTSW 11 78269509 missense probably damaging 1.00
R3788:2610507B11Rik UTSW 11 78288297 critical splice donor site probably null
R3835:2610507B11Rik UTSW 11 78279085 missense probably benign 0.17
R3882:2610507B11Rik UTSW 11 78262700 missense probably damaging 1.00
R3943:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3944:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3945:2610507B11Rik UTSW 11 78289964 missense probably damaging 1.00
R4196:2610507B11Rik UTSW 11 78263556 intron probably benign
R4510:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4511:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4756:2610507B11Rik UTSW 11 78264028 missense probably damaging 0.98
R5337:2610507B11Rik UTSW 11 78265208 missense possibly damaging 0.46
R5419:2610507B11Rik UTSW 11 78272090 nonsense probably null
R5572:2610507B11Rik UTSW 11 78264567 missense probably damaging 0.98
R5719:2610507B11Rik UTSW 11 78273245 missense probably damaging 0.97
R5754:2610507B11Rik UTSW 11 78269541 missense probably damaging 1.00
R5890:2610507B11Rik UTSW 11 78273270 nonsense probably null
R5919:2610507B11Rik UTSW 11 78289350 missense probably damaging 1.00
R5925:2610507B11Rik UTSW 11 78284238 missense probably benign 0.06
R5999:2610507B11Rik UTSW 11 78285468 missense probably damaging 1.00
R6056:2610507B11Rik UTSW 11 78271384 missense possibly damaging 0.77
R6180:2610507B11Rik UTSW 11 78273258 missense possibly damaging 0.51
R6484:2610507B11Rik UTSW 11 78279095 missense probably damaging 1.00
R6721:2610507B11Rik UTSW 11 78279799 missense probably damaging 1.00
R6800:2610507B11Rik UTSW 11 78288279 missense probably benign 0.13
R6911:2610507B11Rik UTSW 11 78268353 missense probably damaging 0.99
R6923:2610507B11Rik UTSW 11 78274626 missense possibly damaging 0.67
X0028:2610507B11Rik UTSW 11 78286635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACCTGGTCCCAATTTATCTG -3'
(R):5'- ATCCCTTTAAAGCCTGAATACCTTC -3'

Sequencing Primer
(F):5'- GTTGTCTTCAGATGCACCAGAAG -3'
(R):5'- GAATACCTTCCTGCTTCTTTAAGAG -3'
Posted On2017-03-31