Incidental Mutation 'R5976:Ranbp3l'
ID471797
Institutional Source Beutler Lab
Gene Symbol Ranbp3l
Ensembl Gene ENSMUSG00000048424
Gene NameRAN binding protein 3-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5976 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location8967949-9067335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 9002093 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 65 (F65C)
Ref Sequence ENSEMBL: ENSMUSP00000130916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053308] [ENSMUST00000166524]
Predicted Effect probably benign
Transcript: ENSMUST00000053308
AA Change: F65C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055750
Gene: ENSMUSG00000048424
AA Change: F65C

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 191 197 N/A INTRINSIC
RanBD 302 430 4.52e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166524
AA Change: F65C

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130916
Gene: ENSMUSG00000048424
AA Change: F65C

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228227
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,284,129 A1697T probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Ankrd26 A T 6: 118,517,894 probably null Het
Arih2 A T 9: 108,607,973 *54R probably null Het
AW146154 T G 7: 41,480,297 K465T probably damaging Het
Bend3 A G 10: 43,510,544 Y311C probably benign Het
Ccdc110 A T 8: 45,943,499 Y809F possibly damaging Het
Ccnh C T 13: 85,190,863 P76L probably damaging Het
Chaf1a T A 17: 56,064,115 C667S probably damaging Het
Clca3a1 A T 3: 144,746,875 Y616N probably damaging Het
Cldn4 A G 5: 134,946,556 C64R probably damaging Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Dclk2 C A 3: 86,787,225 R752L possibly damaging Het
Dzank1 C A 2: 144,501,489 G318W probably damaging Het
Edem1 T A 6: 108,842,962 I236K probably damaging Het
Eif4e1b T C 13: 54,784,822 F75L probably damaging Het
Elmo3 A G 8: 105,307,647 Y266C probably damaging Het
Enpep A G 3: 129,299,124 S509P probably damaging Het
Exoc8 A G 8: 124,896,653 M325T probably benign Het
Fah A G 7: 84,594,741 M270T probably benign Het
Gabbr1 T C 17: 37,067,862 L532P probably damaging Het
Gm10770 T A 2: 150,179,400 K66* probably null Het
Gprc5c A T 11: 114,864,487 Q330L possibly damaging Het
Grin3a T A 4: 49,792,602 H377L probably damaging Het
Hipk3 T C 2: 104,471,184 E221G probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Ighv1-7 T A 12: 114,538,759 E29D probably benign Het
Ing3 T A 6: 21,971,174 S326T probably benign Het
Ipo7 T C 7: 110,048,807 L632P probably damaging Het
Kdm6b A G 11: 69,403,788 probably null Het
Kif21a T G 15: 90,935,812 D1583A probably damaging Het
Lama2 C T 10: 27,190,676 V1070I probably benign Het
Lrp1 A T 10: 127,583,901 S946R probably damaging Het
Lrrc37a A G 11: 103,499,071 S1843P possibly damaging Het
Ltbp1 T C 17: 75,290,083 Y517H probably damaging Het
Map2k4 T A 11: 65,709,952 N51I probably benign Het
Mfsd2b G T 12: 4,866,522 A216D probably damaging Het
Nbea T C 3: 55,853,847 T2025A probably benign Het
Neb A G 2: 52,216,916 V4162A possibly damaging Het
Nr3c1 A T 18: 39,421,549 F599I probably damaging Het
Nsun2 T G 13: 69,623,152 probably null Het
Olfr479 T A 7: 108,055,798 M272K possibly damaging Het
Olfr884 G T 9: 38,047,701 V160F possibly damaging Het
Otoa T A 7: 121,127,713 W524R probably benign Het
Paip1 T A 13: 119,456,997 D182E probably damaging Het
Pde1a G A 2: 79,868,242 Q415* probably null Het
Pfkfb2 T A 1: 130,708,079 K72* probably null Het
Pigg A G 5: 108,332,191 E444G probably null Het
Plec T C 15: 76,189,037 Y669C probably damaging Het
Ptp4a3 T C 15: 73,756,036 V94A possibly damaging Het
Ptprg A G 14: 12,211,625 E969G probably damaging Het
R3hcc1l T A 19: 42,563,350 V262E probably benign Het
Rbm19 T A 5: 120,140,307 S718R probably benign Het
Recql4 C A 15: 76,709,424 R162L probably benign Het
Rest T C 5: 77,268,272 L111P probably benign Het
Rgma T C 7: 73,409,468 S13P probably damaging Het
Rogdi T A 16: 5,013,311 I31F probably benign Het
Serpinb9e T A 13: 33,255,129 D179E probably benign Het
Slc1a5 T C 7: 16,795,882 C409R probably damaging Het
Slc25a38 A G 9: 120,116,547 T38A probably damaging Het
Spag17 C T 3: 100,095,791 Q1897* probably null Het
St7 C A 6: 17,694,222 A4E possibly damaging Het
Tbcel T A 9: 42,439,203 I263F possibly damaging Het
Tmtc3 A G 10: 100,476,672 V103A probably benign Het
Tnc G A 4: 64,018,166 P178S probably benign Het
Vwf A G 6: 125,603,463 D558G unknown Het
Zfp541 A G 7: 16,076,419 K127R probably benign Het
Other mutations in Ranbp3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Ranbp3l APN 15 9063087 nonsense probably null
IGL01982:Ranbp3l APN 15 9058746 missense probably damaging 0.99
IGL02549:Ranbp3l APN 15 8968441 missense possibly damaging 0.66
IGL03170:Ranbp3l APN 15 9000787 missense probably damaging 1.00
IGL03338:Ranbp3l APN 15 9060859 missense probably damaging 1.00
R0137:Ranbp3l UTSW 15 9062987 missense probably damaging 1.00
R0383:Ranbp3l UTSW 15 9063104 missense possibly damaging 0.48
R0699:Ranbp3l UTSW 15 9058769 critical splice donor site probably null
R1517:Ranbp3l UTSW 15 9065001 nonsense probably null
R1629:Ranbp3l UTSW 15 9064988 missense probably damaging 0.99
R1922:Ranbp3l UTSW 15 9057125 missense probably damaging 1.00
R2058:Ranbp3l UTSW 15 9000817 missense probably damaging 1.00
R2265:Ranbp3l UTSW 15 9057113 missense probably damaging 0.99
R2512:Ranbp3l UTSW 15 8968465 missense probably benign 0.00
R4077:Ranbp3l UTSW 15 9060757 missense probably damaging 1.00
R4079:Ranbp3l UTSW 15 9060757 missense probably damaging 1.00
R4179:Ranbp3l UTSW 15 9057198 missense possibly damaging 0.62
R5227:Ranbp3l UTSW 15 9007312 missense probably damaging 0.99
R5265:Ranbp3l UTSW 15 9007203 missense probably benign 0.01
R5722:Ranbp3l UTSW 15 9000832 missense probably damaging 0.98
R5751:Ranbp3l UTSW 15 9063089 missense probably damaging 1.00
R6504:Ranbp3l UTSW 15 8968462 missense probably benign 0.27
R6850:Ranbp3l UTSW 15 9058727 missense probably damaging 1.00
R6940:Ranbp3l UTSW 15 9011919 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTGCAGAAGACTCATTTCTACCTG -3'
(R):5'- AGTTCTTAAACTGCCAGCATGC -3'

Sequencing Primer
(F):5'- CCTGTTCCATGCTAATATGAGACAC -3'
(R):5'- AACTGCCAGCATGCTTTTATTTTTG -3'
Posted On2017-03-31