Incidental Mutation 'R0502:Sqor'
ID47180
Institutional Source Beutler Lab
Gene Symbol Sqor
Ensembl Gene ENSMUSG00000005803
Gene Namesulfide quinone oxidoreductase
Synonyms0610039J17Rik, Sqrdl, flavo-binding protein, 4930557M22Rik
MMRRC Submission 038697-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R0502 (G1)
Quality Score206
Status Validated
Chromosome2
Chromosomal Location122765237-122809569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122798050 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 158 (P158S)
Ref Sequence ENSEMBL: ENSMUSP00000106133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005953] [ENSMUST00000110506] [ENSMUST00000126403] [ENSMUST00000176343]
Predicted Effect probably benign
Transcript: ENSMUST00000005953
AA Change: P158S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005953
Gene: ENSMUSG00000005803
AA Change: P158S

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 44 189 1.7e-11 PFAM
SCOP:d1fcda1 240 364 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110506
AA Change: P158S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106133
Gene: ENSMUSG00000005803
AA Change: P158S

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 342 7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126403
AA Change: P158S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117575
Gene: ENSMUSG00000005803
AA Change: P158S

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 192 8.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176343
SMART Domains Protein: ENSMUSP00000135786
Gene: ENSMUSG00000005803

DomainStartEndE-ValueType
SCOP:d1fl2a1 25 132 6e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176999
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function in mitochondria to catalyze the conversion of sulfide to persulfides, thereby decreasing toxic concencrations of sulfide. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Ano1 A G 7: 144,597,215 L821P probably damaging Het
Apol10b T A 15: 77,592,149 probably benign Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccar2 A G 14: 70,140,982 S625P probably benign Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cep350 A T 1: 155,900,883 probably null Het
Chd3 A G 11: 69,354,105 V1203A probably damaging Het
Col24a1 A G 3: 145,545,316 probably benign Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
D10Wsu102e A G 10: 83,362,056 D42G probably damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dicer1 A T 12: 104,705,060 S984T probably damaging Het
Diexf A T 1: 193,114,828 probably benign Het
Dmbt1 G A 7: 131,097,673 probably null Het
Dnah7b A T 1: 46,219,544 E1965V probably damaging Het
Dpp4 G T 2: 62,364,988 N315K probably damaging Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fat4 T A 3: 39,002,924 S4256R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gpatch4 A G 3: 88,055,365 D295G probably benign Het
Gpbar1 A T 1: 74,279,392 I265F probably benign Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hacl1 A T 14: 31,622,984 probably benign Het
Hnrnpc A G 14: 52,075,172 probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifnar1 T A 16: 91,501,751 C419S probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Itga2 T G 13: 114,845,856 N1038H probably benign Het
Kif16b C T 2: 142,712,155 D908N probably benign Het
Lamc1 A G 1: 153,246,932 probably benign Het
Lrig3 A G 10: 126,008,736 T690A probably damaging Het
Lrp2 T C 2: 69,511,017 K940E probably damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mrps27 G T 13: 99,409,795 probably benign Het
Ncam1 A G 9: 49,569,818 probably benign Het
Olfr30 T C 11: 58,455,314 I212V possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Pbrm1 T G 14: 31,064,820 D631E probably benign Het
Pdc A T 1: 150,328,414 probably benign Het
Pkd1 T C 17: 24,574,792 S1818P probably damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rab35 G A 5: 115,645,664 R170Q probably benign Het
Rerg A T 6: 137,056,307 C123* probably null Het
Ros1 A G 10: 52,194,823 probably benign Het
Siglece A G 7: 43,659,931 Y68H probably damaging Het
Slc28a2 T A 2: 122,458,281 probably null Het
Slc4a11 T C 2: 130,688,157 K234E probably damaging Het
Tcerg1 C T 18: 42,522,956 P110S unknown Het
Tm6sf2 T A 8: 70,077,941 Y224N probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Ttll10 T C 4: 156,047,548 probably benign Het
Ubap2l A T 3: 90,009,213 L898Q probably damaging Het
Uggt1 A T 1: 36,159,946 V1207E probably damaging Het
Uhrf2 A G 19: 30,092,776 D775G probably damaging Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn1r87 T G 7: 13,131,656 T235P probably damaging Het
Vmn2r96 T A 17: 18,584,000 M504K probably benign Het
Zdbf2 A T 1: 63,305,290 I943F possibly damaging Het
Zfp78 A G 7: 6,373,158 D22G probably damaging Het
Zfp827 C T 8: 79,179,077 probably null Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Other mutations in Sqor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Sqor APN 2 122787543 missense probably damaging 0.97
IGL01544:Sqor APN 2 122792346 splice site probably benign
IGL02499:Sqor APN 2 122808087 missense possibly damaging 0.93
IGL02583:Sqor APN 2 122799770 missense probably damaging 0.98
IGL02732:Sqor APN 2 122799762 missense possibly damaging 0.76
IGL03137:Sqor APN 2 122808071 missense probably benign
H8786:Sqor UTSW 2 122792368 missense probably benign 0.10
R0126:Sqor UTSW 2 122798027 unclassified probably benign
R0410:Sqor UTSW 2 122787522 missense probably benign
R0709:Sqor UTSW 2 122799855 missense probably benign 0.38
R1486:Sqor UTSW 2 122807645 splice site probably null
R2001:Sqor UTSW 2 122798098 missense probably damaging 0.98
R2020:Sqor UTSW 2 122804107 critical splice donor site probably null
R2039:Sqor UTSW 2 122792404 critical splice donor site probably null
R2404:Sqor UTSW 2 122808023 missense probably benign
R4213:Sqor UTSW 2 122787498 missense probably damaging 1.00
R4909:Sqor UTSW 2 122785181 missense possibly damaging 0.82
R5630:Sqor UTSW 2 122809357 missense possibly damaging 0.71
R5659:Sqor UTSW 2 122787603 missense probably benign 0.02
R5728:Sqor UTSW 2 122809400 makesense probably null
R5772:Sqor UTSW 2 122809341 missense probably benign 0.00
R6527:Sqor UTSW 2 122809286 missense probably damaging 0.98
R6657:Sqor UTSW 2 122807594 missense possibly damaging 0.68
R6843:Sqor UTSW 2 122784980 missense probably benign 0.00
R6843:Sqor UTSW 2 122809295 missense probably damaging 0.99
R7193:Sqor UTSW 2 122804009 missense probably damaging 1.00
R7320:Sqor UTSW 2 122799810 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTAGGCCCCTTCCTTCCCTAAAATAC -3'
(R):5'- TGCATAGTGAGTGGTCTCTACATCCAG -3'

Sequencing Primer
(F):5'- ctcacacacacacacacac -3'
(R):5'- AGCCGTACCTTCCTGAAGTAG -3'
Posted On2013-06-12