Incidental Mutation 'R5976:Gabbr1'
ID471804
Institutional Source Beutler Lab
Gene Symbol Gabbr1
Ensembl Gene ENSMUSG00000024462
Gene Namegamma-aminobutyric acid (GABA) B receptor, 1
SynonymsGABAB1, GABAbR1
MMRRC Submission 044158-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R5976 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37045966-37075067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37067862 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 532 (L532P)
Ref Sequence ENSEMBL: ENSMUSP00000134268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823]
Predicted Effect probably damaging
Transcript: ENSMUST00000025338
AA Change: L648P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: L648P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Pfam:Peripla_BP_6 168 538 1.6e-23 PFAM
Pfam:ANF_receptor 186 542 4.3e-73 PFAM
Pfam:7tm_3 602 858 9.8e-49 PFAM
coiled coil region 877 922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172792
AA Change: L532P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: L532P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:Peripla_BP_6 52 428 7.8e-24 PFAM
Pfam:ANF_receptor 70 426 5.7e-68 PFAM
Pfam:7tm_3 484 743 1.1e-50 PFAM
coiled coil region 761 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173823
SMART Domains Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 29 95 1.6e-6 PFAM
low complexity region 159 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174181
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,284,129 A1697T probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Ankrd26 A T 6: 118,517,894 probably null Het
Arih2 A T 9: 108,607,973 *54R probably null Het
AW146154 T G 7: 41,480,297 K465T probably damaging Het
Bend3 A G 10: 43,510,544 Y311C probably benign Het
Ccdc110 A T 8: 45,943,499 Y809F possibly damaging Het
Ccnh C T 13: 85,190,863 P76L probably damaging Het
Chaf1a T A 17: 56,064,115 C667S probably damaging Het
Clca3a1 A T 3: 144,746,875 Y616N probably damaging Het
Cldn4 A G 5: 134,946,556 C64R probably damaging Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Dclk2 C A 3: 86,787,225 R752L possibly damaging Het
Dzank1 C A 2: 144,501,489 G318W probably damaging Het
Edem1 T A 6: 108,842,962 I236K probably damaging Het
Eif4e1b T C 13: 54,784,822 F75L probably damaging Het
Elmo3 A G 8: 105,307,647 Y266C probably damaging Het
Enpep A G 3: 129,299,124 S509P probably damaging Het
Exoc8 A G 8: 124,896,653 M325T probably benign Het
Fah A G 7: 84,594,741 M270T probably benign Het
Gm10770 T A 2: 150,179,400 K66* probably null Het
Gprc5c A T 11: 114,864,487 Q330L possibly damaging Het
Grin3a T A 4: 49,792,602 H377L probably damaging Het
Hipk3 T C 2: 104,471,184 E221G probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Ighv1-7 T A 12: 114,538,759 E29D probably benign Het
Ing3 T A 6: 21,971,174 S326T probably benign Het
Ipo7 T C 7: 110,048,807 L632P probably damaging Het
Kdm6b A G 11: 69,403,788 probably null Het
Kif21a T G 15: 90,935,812 D1583A probably damaging Het
Lama2 C T 10: 27,190,676 V1070I probably benign Het
Lrp1 A T 10: 127,583,901 S946R probably damaging Het
Lrrc37a A G 11: 103,499,071 S1843P possibly damaging Het
Ltbp1 T C 17: 75,290,083 Y517H probably damaging Het
Map2k4 T A 11: 65,709,952 N51I probably benign Het
Mfsd2b G T 12: 4,866,522 A216D probably damaging Het
Nbea T C 3: 55,853,847 T2025A probably benign Het
Neb A G 2: 52,216,916 V4162A possibly damaging Het
Nr3c1 A T 18: 39,421,549 F599I probably damaging Het
Nsun2 T G 13: 69,623,152 probably null Het
Olfr479 T A 7: 108,055,798 M272K possibly damaging Het
Olfr884 G T 9: 38,047,701 V160F possibly damaging Het
Otoa T A 7: 121,127,713 W524R probably benign Het
Paip1 T A 13: 119,456,997 D182E probably damaging Het
Pde1a G A 2: 79,868,242 Q415* probably null Het
Pfkfb2 T A 1: 130,708,079 K72* probably null Het
Pigg A G 5: 108,332,191 E444G probably null Het
Plec T C 15: 76,189,037 Y669C probably damaging Het
Ptp4a3 T C 15: 73,756,036 V94A possibly damaging Het
Ptprg A G 14: 12,211,625 E969G probably damaging Het
R3hcc1l T A 19: 42,563,350 V262E probably benign Het
Ranbp3l T G 15: 9,002,093 F65C possibly damaging Het
Rbm19 T A 5: 120,140,307 S718R probably benign Het
Recql4 C A 15: 76,709,424 R162L probably benign Het
Rest T C 5: 77,268,272 L111P probably benign Het
Rgma T C 7: 73,409,468 S13P probably damaging Het
Rogdi T A 16: 5,013,311 I31F probably benign Het
Serpinb9e T A 13: 33,255,129 D179E probably benign Het
Slc1a5 T C 7: 16,795,882 C409R probably damaging Het
Slc25a38 A G 9: 120,116,547 T38A probably damaging Het
Spag17 C T 3: 100,095,791 Q1897* probably null Het
St7 C A 6: 17,694,222 A4E possibly damaging Het
Tbcel T A 9: 42,439,203 I263F possibly damaging Het
Tmtc3 A G 10: 100,476,672 V103A probably benign Het
Tnc G A 4: 64,018,166 P178S probably benign Het
Vwf A G 6: 125,603,463 D558G Het
Zfp541 A G 7: 16,076,419 K127R probably benign Het
Other mutations in Gabbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gabbr1 APN 17 37048443 nonsense probably null
IGL01309:Gabbr1 APN 17 37048607 critical splice donor site probably null
IGL01413:Gabbr1 APN 17 37062706 missense possibly damaging 0.93
IGL01568:Gabbr1 APN 17 37070669 missense probably damaging 1.00
IGL01845:Gabbr1 APN 17 37048414 splice site probably benign
IGL02083:Gabbr1 APN 17 37070065 missense possibly damaging 0.84
IGL02302:Gabbr1 APN 17 37054797 missense probably damaging 1.00
IGL02430:Gabbr1 APN 17 37056308 nonsense probably null
IGL02533:Gabbr1 APN 17 37072147 missense probably damaging 1.00
IGL02810:Gabbr1 APN 17 37062762 missense probably damaging 1.00
H8562:Gabbr1 UTSW 17 37071949 missense probably damaging 1.00
PIT4449001:Gabbr1 UTSW 17 37056350 missense probably damaging 1.00
R0025:Gabbr1 UTSW 17 37067210 intron probably benign
R0420:Gabbr1 UTSW 17 37046762 missense possibly damaging 0.68
R0464:Gabbr1 UTSW 17 37050834 unclassified probably benign
R1306:Gabbr1 UTSW 17 37055990 intron probably null
R1412:Gabbr1 UTSW 17 37054913 splice site probably null
R1495:Gabbr1 UTSW 17 37055940 missense possibly damaging 0.68
R1612:Gabbr1 UTSW 17 37070669 missense probably damaging 1.00
R1658:Gabbr1 UTSW 17 37047507 missense probably damaging 0.96
R1763:Gabbr1 UTSW 17 37054767 missense probably damaging 1.00
R1779:Gabbr1 UTSW 17 37054879 missense probably damaging 1.00
R1964:Gabbr1 UTSW 17 37048459 missense probably damaging 1.00
R1996:Gabbr1 UTSW 17 37069220 missense probably damaging 1.00
R2014:Gabbr1 UTSW 17 37056782 splice site probably null
R2255:Gabbr1 UTSW 17 37071866 missense probably damaging 1.00
R4299:Gabbr1 UTSW 17 37055900 nonsense probably null
R4458:Gabbr1 UTSW 17 37067775 critical splice acceptor site probably null
R4510:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4511:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4571:Gabbr1 UTSW 17 37054236 nonsense probably null
R4597:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.74
R5109:Gabbr1 UTSW 17 37072028 intron probably benign
R5119:Gabbr1 UTSW 17 37048438 missense probably damaging 0.99
R5227:Gabbr1 UTSW 17 37070066 missense possibly damaging 0.93
R5253:Gabbr1 UTSW 17 37055913 missense possibly damaging 0.87
R5443:Gabbr1 UTSW 17 37070756 missense probably damaging 1.00
R5485:Gabbr1 UTSW 17 37056875 missense possibly damaging 0.83
R5839:Gabbr1 UTSW 17 37067868 missense probably damaging 1.00
R6156:Gabbr1 UTSW 17 37048427 missense probably benign 0.01
R6167:Gabbr1 UTSW 17 37063379 missense probably damaging 1.00
R6214:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6215:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6348:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.94
R6721:Gabbr1 UTSW 17 37054192 missense probably damaging 0.98
R7028:Gabbr1 UTSW 17 37064737 nonsense probably null
R7317:Gabbr1 UTSW 17 37069413 missense probably damaging 1.00
X0010:Gabbr1 UTSW 17 37070780 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGGCATTTCTGGAGAGCC -3'
(R):5'- TGTAGAATGGAATAGGTCTGGCAC -3'

Sequencing Primer
(F):5'- ATTTCTGGAGAGCCGAGCCTC -3'
(R):5'- CCAGAGCTAGAGCCAGAGC -3'
Posted On2017-03-31