Incidental Mutation 'R5961:Aen'
List |< first << previous [record 75 of 1871] next >> last >|
ID471828
Institutional Source Beutler Lab
Gene Symbol Aen
Ensembl Gene ENSMUSG00000030609
Gene Nameapoptosis enhancing nuclease
SynonymsIsg20l1, 2700083B06Rik
MMRRC Submission 043247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R5961 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location78895854-78911209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 78907159 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 252 (H252D)
Ref Sequence ENSEMBL: ENSMUSP00000103048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107421] [ENSMUST00000107423] [ENSMUST00000107425] [ENSMUST00000138167] [ENSMUST00000205861] [ENSMUST00000205882]
Predicted Effect probably damaging
Transcript: ENSMUST00000107421
AA Change: H214D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103044
Gene: ENSMUSG00000030609
AA Change: H214D

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
EXOIII 70 236 2.04e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107423
AA Change: H252D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103046
Gene: ENSMUSG00000030609
AA Change: H252D

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
EXOIII 108 274 2.04e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107425
AA Change: H252D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103048
Gene: ENSMUSG00000030609
AA Change: H252D

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
EXOIII 108 274 2.04e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123824
Predicted Effect probably benign
Transcript: ENSMUST00000138167
SMART Domains Protein: ENSMUSP00000117331
Gene: ENSMUSG00000030609

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
Pfam:RNase_T 72 138 1.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205861
AA Change: H110D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000205882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206661
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,611,064 T26A possibly damaging Het
Ackr4 A G 9: 104,099,139 L203P probably damaging Het
Alkbh6 T A 7: 30,314,192 probably null Het
Birc6 T C 17: 74,646,601 V3286A probably damaging Het
Cacna1h A G 17: 25,377,272 M1925T probably benign Het
Caprin2 A C 6: 148,863,540 S554R probably damaging Het
Celsr3 T C 9: 108,831,794 S1280P probably damaging Het
Cfap57 T C 4: 118,571,745 E1008G probably benign Het
Csmd1 A G 8: 16,070,352 I1813T probably damaging Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dnah2 A G 11: 69,431,148 F3782S probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnajc17 T C 2: 119,186,046 T64A possibly damaging Het
Dvl3 T G 16: 20,530,979 S567R possibly damaging Het
Epb41l1 T A 2: 156,521,786 S738R probably benign Het
Exph5 T C 9: 53,377,255 W1879R probably damaging Het
Fam83a T A 15: 58,009,596 F274I possibly damaging Het
Ggt1 A G 10: 75,585,902 probably null Het
Ido2 C T 8: 24,533,770 V351M probably damaging Het
Kcnt2 A G 1: 140,507,702 E469G possibly damaging Het
Kdm2b A G 5: 122,932,661 S403P probably benign Het
Klhl2 C T 8: 64,749,784 R460H probably damaging Het
Mfsd6l A G 11: 68,556,542 Y73C possibly damaging Het
Mlec A T 5: 115,150,100 C205* probably null Het
Mlx T C 11: 101,089,227 Y129H probably damaging Het
Mmadhc T C 2: 50,291,409 H83R probably damaging Het
Mmp16 T C 4: 17,853,842 F41S probably benign Het
Mroh6 G A 15: 75,887,768 Q187* probably null Het
Myh14 T A 7: 44,623,094 E1437V probably damaging Het
Nrxn1 A C 17: 90,454,943 L37R probably damaging Het
Olfr799 T C 10: 129,647,854 M242T possibly damaging Het
Pkhd1l1 A C 15: 44,459,463 R48S probably damaging Het
Prokr2 A G 2: 132,373,675 Y128H possibly damaging Het
Prtg T C 9: 72,856,946 V567A probably benign Het
Srrm2 G A 17: 23,820,109 probably benign Het
Stat4 A T 1: 52,065,384 I115L possibly damaging Het
Tnxb G A 17: 34,718,635 V3833M probably damaging Het
Ugt2b36 C T 5: 87,080,865 probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Usp47 T C 7: 112,053,316 S47P probably damaging Het
Vps53 A G 11: 76,048,490 Y696H probably damaging Het
Zfp384 T C 6: 125,024,034 I23T probably damaging Het
Zfp804a A G 2: 82,258,002 Y725C probably benign Het
Other mutations in Aen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Aen APN 7 78907302 missense probably damaging 0.96
IGL01062:Aen APN 7 78907302 missense probably damaging 0.96
IGL01065:Aen APN 7 78907302 missense probably damaging 0.96
IGL01067:Aen APN 7 78907302 missense probably damaging 0.96
IGL01068:Aen APN 7 78907302 missense probably damaging 0.96
IGL01069:Aen APN 7 78907302 missense probably damaging 0.96
IGL01070:Aen APN 7 78907302 missense probably damaging 0.96
IGL01086:Aen APN 7 78907302 missense probably damaging 0.96
IGL01089:Aen APN 7 78907302 missense probably damaging 0.96
IGL01126:Aen APN 7 78907302 missense probably damaging 0.96
IGL01128:Aen APN 7 78907302 missense probably damaging 0.96
IGL01133:Aen APN 7 78907302 missense probably damaging 0.96
IGL01134:Aen APN 7 78907302 missense probably damaging 0.96
IGL01147:Aen APN 7 78907302 missense probably damaging 0.96
R1433:Aen UTSW 7 78907312 missense probably damaging 1.00
R1543:Aen UTSW 7 78902622 missense probably damaging 1.00
R1615:Aen UTSW 7 78905912 missense probably damaging 1.00
R1886:Aen UTSW 7 78907325 missense probably damaging 0.98
R1887:Aen UTSW 7 78907325 missense probably damaging 0.98
R1918:Aen UTSW 7 78906029 missense possibly damaging 0.96
R1919:Aen UTSW 7 78905912 missense probably damaging 1.00
R1946:Aen UTSW 7 78902672 missense probably damaging 1.00
R2192:Aen UTSW 7 78906045 critical splice donor site probably null
R2224:Aen UTSW 7 78902451 missense probably benign 0.30
R2225:Aen UTSW 7 78902451 missense probably benign 0.30
R2226:Aen UTSW 7 78902451 missense probably benign 0.30
R2244:Aen UTSW 7 78907297 missense probably damaging 1.00
R2516:Aen UTSW 7 78905868 missense probably damaging 1.00
R4943:Aen UTSW 7 78902361 missense probably damaging 0.99
R5634:Aen UTSW 7 78902507 missense probably benign 0.01
R5834:Aen UTSW 7 78907301 missense probably damaging 1.00
R6130:Aen UTSW 7 78902639 unclassified probably null
R6255:Aen UTSW 7 78905844 missense probably damaging 1.00
R6400:Aen UTSW 7 78907394 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACTGTGAGCTGGGAACAAG -3'
(R):5'- AATCCTACCCCGTGACTAGG -3'

Sequencing Primer
(F):5'- GCCCACAGCACACAGAC -3'
(R):5'- CGTGACTAGGGAGGAGCACTC -3'
Posted On2017-03-31