Incidental Mutation 'R5961:Exph5'
ID 471834
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Name exophilin 5
Synonyms AC079869.22gm5, Slac2b, slac2-b, B130009M24Rik
MMRRC Submission 043247-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5961 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 53212970-53288814 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53288555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1879 (W1879R)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
AlphaFold Q0VAV2
Predicted Effect probably damaging
Transcript: ENSMUST00000051014
AA Change: W1879R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: W1879R

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 103,976,338 (GRCm39) L203P probably damaging Het
Aen C G 7: 78,556,907 (GRCm39) H252D probably damaging Het
Alkbh6 T A 7: 30,013,617 (GRCm39) probably null Het
Birc6 T C 17: 74,953,596 (GRCm39) V3286A probably damaging Het
Cacna1h A G 17: 25,596,246 (GRCm39) M1925T probably benign Het
Caprin2 A C 6: 148,765,038 (GRCm39) S554R probably damaging Het
Celsr3 T C 9: 108,708,993 (GRCm39) S1280P probably damaging Het
Cfap57 T C 4: 118,428,942 (GRCm39) E1008G probably benign Het
Csmd1 A G 8: 16,120,366 (GRCm39) I1813T probably damaging Het
Dnah10 A G 5: 124,888,546 (GRCm39) E3050G probably benign Het
Dnah2 A G 11: 69,321,974 (GRCm39) F3782S probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dnajc17 T C 2: 119,016,527 (GRCm39) T64A possibly damaging Het
Dvl3 T G 16: 20,349,729 (GRCm39) S567R possibly damaging Het
Epb41l1 T A 2: 156,363,706 (GRCm39) S738R probably benign Het
Fam83a T A 15: 57,872,992 (GRCm39) F274I possibly damaging Het
Ggt1 A G 10: 75,421,736 (GRCm39) probably null Het
Ido2 C T 8: 25,023,786 (GRCm39) V351M probably damaging Het
Kcnt2 A G 1: 140,435,440 (GRCm39) E469G possibly damaging Het
Kdm2b A G 5: 123,070,724 (GRCm39) S403P probably benign Het
Klhl2 C T 8: 65,202,818 (GRCm39) R460H probably damaging Het
Mfsd6l A G 11: 68,447,368 (GRCm39) Y73C possibly damaging Het
Mlec A T 5: 115,288,159 (GRCm39) C205* probably null Het
Mlx T C 11: 100,980,053 (GRCm39) Y129H probably damaging Het
Mmadhc T C 2: 50,181,421 (GRCm39) H83R probably damaging Het
Mmp16 T C 4: 17,853,842 (GRCm39) F41S probably benign Het
Mroh6 G A 15: 75,759,617 (GRCm39) Q187* probably null Het
Myh14 T A 7: 44,272,518 (GRCm39) E1437V probably damaging Het
Nrxn1 A C 17: 90,762,371 (GRCm39) L37R probably damaging Het
Or6c209 T C 10: 129,483,723 (GRCm39) M242T possibly damaging Het
Pkhd1l1 A C 15: 44,322,859 (GRCm39) R48S probably damaging Het
Prokr2 A G 2: 132,215,595 (GRCm39) Y128H possibly damaging Het
Prtg T C 9: 72,764,228 (GRCm39) V567A probably benign Het
Rbis T C 3: 14,676,124 (GRCm39) T26A possibly damaging Het
Srrm2 G A 17: 24,039,083 (GRCm39) probably benign Het
Stat4 A T 1: 52,104,543 (GRCm39) I115L possibly damaging Het
Tnxb G A 17: 34,937,609 (GRCm39) V3833M probably damaging Het
Ugt2b36 C T 5: 87,228,724 (GRCm39) probably null Het
Usp45 A C 4: 21,810,797 (GRCm39) D331A probably damaging Het
Usp47 T C 7: 111,652,523 (GRCm39) S47P probably damaging Het
Vps53 A G 11: 75,939,316 (GRCm39) Y696H probably damaging Het
Zfp384 T C 6: 125,000,997 (GRCm39) I23T probably damaging Het
Zfp804a A G 2: 82,088,346 (GRCm39) Y725C probably benign Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53,288,006 (GRCm39) nonsense probably null
IGL01387:Exph5 APN 9 53,285,265 (GRCm39) missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53,287,869 (GRCm39) missense probably damaging 0.99
IGL02122:Exph5 APN 9 53,284,974 (GRCm39) missense probably benign 0.05
IGL02156:Exph5 APN 9 53,286,941 (GRCm39) missense probably damaging 0.96
IGL02192:Exph5 APN 9 53,287,625 (GRCm39) nonsense probably null
IGL02491:Exph5 APN 9 53,286,343 (GRCm39) missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53,286,278 (GRCm39) missense probably damaging 0.96
R0002:Exph5 UTSW 9 53,285,256 (GRCm39) missense probably damaging 0.99
R0026:Exph5 UTSW 9 53,287,779 (GRCm39) missense probably benign 0.38
R0086:Exph5 UTSW 9 53,249,230 (GRCm39) missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53,264,504 (GRCm39) critical splice donor site probably null
R0369:Exph5 UTSW 9 53,284,602 (GRCm39) missense probably benign 0.35
R0409:Exph5 UTSW 9 53,285,643 (GRCm39) missense probably benign 0.00
R0517:Exph5 UTSW 9 53,284,062 (GRCm39) missense probably benign 0.02
R0658:Exph5 UTSW 9 53,288,775 (GRCm39) missense unknown
R1606:Exph5 UTSW 9 53,285,595 (GRCm39) missense probably benign 0.37
R1739:Exph5 UTSW 9 53,286,888 (GRCm39) missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53,285,109 (GRCm39) missense probably benign 0.35
R1828:Exph5 UTSW 9 53,287,941 (GRCm39) missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53,287,548 (GRCm39) missense probably benign
R1993:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53,278,466 (GRCm39) missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53,283,979 (GRCm39) missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53,286,225 (GRCm39) nonsense probably null
R3817:Exph5 UTSW 9 53,286,794 (GRCm39) nonsense probably null
R4771:Exph5 UTSW 9 53,284,965 (GRCm39) missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53,287,539 (GRCm39) missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53,287,925 (GRCm39) missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53,286,910 (GRCm39) missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53,249,230 (GRCm39) missense probably damaging 0.99
R5522:Exph5 UTSW 9 53,285,613 (GRCm39) missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53,286,522 (GRCm39) missense probably benign 0.04
R6093:Exph5 UTSW 9 53,283,917 (GRCm39) missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53,284,328 (GRCm39) missense probably benign 0.21
R6254:Exph5 UTSW 9 53,284,010 (GRCm39) missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53,287,991 (GRCm39) missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53,213,012 (GRCm39) start gained probably benign
R6792:Exph5 UTSW 9 53,286,617 (GRCm39) missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53,251,728 (GRCm39) missense probably benign 0.27
R7340:Exph5 UTSW 9 53,288,309 (GRCm39) missense probably damaging 0.99
R7347:Exph5 UTSW 9 53,287,196 (GRCm39) missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53,287,022 (GRCm39) missense probably benign 0.00
R7520:Exph5 UTSW 9 53,278,514 (GRCm39) critical splice donor site probably null
R7521:Exph5 UTSW 9 53,285,377 (GRCm39) missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53,287,073 (GRCm39) missense probably benign 0.41
R7581:Exph5 UTSW 9 53,283,857 (GRCm39) missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53,284,475 (GRCm39) missense possibly damaging 0.62
R7976:Exph5 UTSW 9 53,287,935 (GRCm39) missense possibly damaging 0.79
R8017:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8019:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8302:Exph5 UTSW 9 53,287,776 (GRCm39) missense possibly damaging 0.89
R8420:Exph5 UTSW 9 53,287,148 (GRCm39) nonsense probably null
R8551:Exph5 UTSW 9 53,285,351 (GRCm39) missense possibly damaging 0.94
R8708:Exph5 UTSW 9 53,287,096 (GRCm39) missense probably benign
R8889:Exph5 UTSW 9 53,287,955 (GRCm39) missense probably damaging 1.00
R9048:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R9255:Exph5 UTSW 9 53,284,609 (GRCm39) missense possibly damaging 0.79
R9727:Exph5 UTSW 9 53,287,702 (GRCm39) missense probably damaging 0.96
X0028:Exph5 UTSW 9 53,287,563 (GRCm39) missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53,288,719 (GRCm39) missense probably benign
Z1177:Exph5 UTSW 9 53,285,513 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AAGATGGCTCCTTCCCCAAC -3'
(R):5'- TGTCTGTGTCCCAGTCTGAG -3'

Sequencing Primer
(F):5'- GCTCCTTCCCCAACAGTGG -3'
(R):5'- TGTGTCCCAGTCTGAGACCAG -3'
Posted On 2017-03-31