Incidental Mutation 'R5961:Prtg'
ID471835
Institutional Source Beutler Lab
Gene Symbol Prtg
Ensembl Gene ENSMUSG00000036030
Gene Nameprotogenin
SynonymsIgdcc5, A230098A12Rik
MMRRC Submission 043247-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R5961 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72806874-72917291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72856946 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 567 (V567A)
Ref Sequence ENSEMBL: ENSMUSP00000055815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055535]
Predicted Effect probably benign
Transcript: ENSMUST00000055535
AA Change: V567A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055815
Gene: ENSMUSG00000036030
AA Change: V567A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 45 114 1.7e-8 SMART
IGc2 141 206 8.5e-12 SMART
IGc2 241 305 6.9e-12 SMART
IGc2 333 396 9.4e-10 SMART
FN3 413 496 8.9e-11 SMART
FN3 511 594 1.3e-10 SMART
FN3 613 693 1.5e-5 SMART
FN3 715 798 3e-10 SMART
FN3 814 898 4.4e-12 SMART
transmembrane domain 943 965 N/A INTRINSIC
low complexity region 966 976 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded transmembrane protein has been associated with the development of various tissues, especially neurogenesis. It has been suggested that this gene may be associated with attention deficit hyperactivity disorder (ADHD). [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,611,064 T26A possibly damaging Het
Ackr4 A G 9: 104,099,139 L203P probably damaging Het
Aen C G 7: 78,907,159 H252D probably damaging Het
Alkbh6 T A 7: 30,314,192 probably null Het
Birc6 T C 17: 74,646,601 V3286A probably damaging Het
Cacna1h A G 17: 25,377,272 M1925T probably benign Het
Caprin2 A C 6: 148,863,540 S554R probably damaging Het
Celsr3 T C 9: 108,831,794 S1280P probably damaging Het
Cfap57 T C 4: 118,571,745 E1008G probably benign Het
Csmd1 A G 8: 16,070,352 I1813T probably damaging Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dnah2 A G 11: 69,431,148 F3782S probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnajc17 T C 2: 119,186,046 T64A possibly damaging Het
Dvl3 T G 16: 20,530,979 S567R possibly damaging Het
Epb41l1 T A 2: 156,521,786 S738R probably benign Het
Exph5 T C 9: 53,377,255 W1879R probably damaging Het
Fam83a T A 15: 58,009,596 F274I possibly damaging Het
Ggt1 A G 10: 75,585,902 probably null Het
Ido2 C T 8: 24,533,770 V351M probably damaging Het
Kcnt2 A G 1: 140,507,702 E469G possibly damaging Het
Kdm2b A G 5: 122,932,661 S403P probably benign Het
Klhl2 C T 8: 64,749,784 R460H probably damaging Het
Mfsd6l A G 11: 68,556,542 Y73C possibly damaging Het
Mlec A T 5: 115,150,100 C205* probably null Het
Mlx T C 11: 101,089,227 Y129H probably damaging Het
Mmadhc T C 2: 50,291,409 H83R probably damaging Het
Mmp16 T C 4: 17,853,842 F41S probably benign Het
Mroh6 G A 15: 75,887,768 Q187* probably null Het
Myh14 T A 7: 44,623,094 E1437V probably damaging Het
Nrxn1 A C 17: 90,454,943 L37R probably damaging Het
Olfr799 T C 10: 129,647,854 M242T possibly damaging Het
Pkhd1l1 A C 15: 44,459,463 R48S probably damaging Het
Prokr2 A G 2: 132,373,675 Y128H possibly damaging Het
Srrm2 G A 17: 23,820,109 probably benign Het
Stat4 A T 1: 52,065,384 I115L possibly damaging Het
Tnxb G A 17: 34,718,635 V3833M probably damaging Het
Ugt2b36 C T 5: 87,080,865 probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Usp47 T C 7: 112,053,316 S47P probably damaging Het
Vps53 A G 11: 76,048,490 Y696H probably damaging Het
Zfp384 T C 6: 125,024,034 I23T probably damaging Het
Zfp804a A G 2: 82,258,002 Y725C probably benign Het
Other mutations in Prtg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Prtg APN 9 72809644 missense probably damaging 1.00
IGL00942:Prtg APN 9 72892340 missense possibly damaging 0.82
IGL01821:Prtg APN 9 72911937 missense probably damaging 0.98
IGL01901:Prtg APN 9 72855066 missense probably damaging 1.00
IGL02143:Prtg APN 9 72892324 missense probably damaging 1.00
IGL02232:Prtg APN 9 72851489 missense probably damaging 1.00
IGL02451:Prtg APN 9 72856999 missense possibly damaging 0.95
IGL02510:Prtg APN 9 72890869 missense probably damaging 0.99
IGL02739:Prtg APN 9 72851585 missense possibly damaging 0.92
IGL03136:Prtg APN 9 72856985 missense possibly damaging 0.91
FR4548:Prtg UTSW 9 72857081 critical splice donor site probably benign
FR4589:Prtg UTSW 9 72856865 missense probably damaging 1.00
FR4737:Prtg UTSW 9 72857081 critical splice donor site probably benign
R0130:Prtg UTSW 9 72809716 missense probably damaging 1.00
R0321:Prtg UTSW 9 72848025 missense possibly damaging 0.83
R0390:Prtg UTSW 9 72844958 missense probably benign 0.24
R0900:Prtg UTSW 9 72844943 missense probably benign
R1121:Prtg UTSW 9 72906167 missense probably benign 0.15
R1438:Prtg UTSW 9 72910750 splice site probably benign
R1537:Prtg UTSW 9 72809757 missense probably benign 0.00
R1590:Prtg UTSW 9 72842807 missense probably benign
R1626:Prtg UTSW 9 72844911 missense probably damaging 1.00
R1965:Prtg UTSW 9 72848322 missense probably benign 0.27
R1993:Prtg UTSW 9 72844896 missense probably benign
R2351:Prtg UTSW 9 72856824 missense probably damaging 1.00
R3737:Prtg UTSW 9 72842709 nonsense probably null
R3921:Prtg UTSW 9 72848347 missense probably damaging 0.98
R4035:Prtg UTSW 9 72842709 nonsense probably null
R4378:Prtg UTSW 9 72842760 missense possibly damaging 0.91
R4687:Prtg UTSW 9 72890798 missense probably damaging 1.00
R5469:Prtg UTSW 9 72891965 missense probably damaging 0.98
R5556:Prtg UTSW 9 72851704 missense probably damaging 1.00
R5563:Prtg UTSW 9 72856898 missense probably damaging 1.00
R5710:Prtg UTSW 9 72809640 missense probably damaging 1.00
R5738:Prtg UTSW 9 72912006 missense probably benign 0.16
R5868:Prtg UTSW 9 72809717 nonsense probably null
R5964:Prtg UTSW 9 72892254 missense probably benign 0.41
R6217:Prtg UTSW 9 72904794 missense probably damaging 1.00
R6306:Prtg UTSW 9 72906186 missense probably benign 0.42
R6395:Prtg UTSW 9 72912132 missense possibly damaging 0.80
R6455:Prtg UTSW 9 72907856 missense probably damaging 1.00
R6673:Prtg UTSW 9 72851682 missense probably damaging 0.99
R6985:Prtg UTSW 9 72851501 missense probably damaging 1.00
R7014:Prtg UTSW 9 72891985 missense possibly damaging 0.95
R7233:Prtg UTSW 9 72911991 missense probably benign 0.00
R7261:Prtg UTSW 9 72907835 missense possibly damaging 0.94
R7324:Prtg UTSW 9 72890840 missense probably damaging 0.96
R7372:Prtg UTSW 9 72851566 nonsense probably null
X0028:Prtg UTSW 9 72851716 missense possibly damaging 0.55
X0064:Prtg UTSW 9 72904892 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGACCATGTTATGCTTTGCC -3'
(R):5'- CTTCCTAAACAGTCCCCAGGAG -3'

Sequencing Primer
(F):5'- ATTTCACTAGTGCCCCTAAGAC -3'
(R):5'- GAGGCGTTACCCGTTCGTTAC -3'
Posted On2017-03-31