Incidental Mutation 'R5963:Nom1'
ID471868
Institutional Source Beutler Lab
Gene Symbol Nom1
Ensembl Gene ENSMUSG00000001569
Gene Namenucleolar protein with MIF4G domain 1
SynonymsGm1040, LOC381627, D5Kng1
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location29434664-29457843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29437770 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 423 (L423P)
Ref Sequence ENSEMBL: ENSMUSP00000001611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001611]
Predicted Effect probably damaging
Transcript: ENSMUST00000001611
AA Change: L423P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001611
Gene: ENSMUSG00000001569
AA Change: L423P

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 102 114 N/A INTRINSIC
low complexity region 119 147 N/A INTRINSIC
coiled coil region 170 197 N/A INTRINSIC
low complexity region 227 250 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
MIF4G 356 553 1.1e-21 SMART
MA3 649 755 1.59e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146347
Meta Mutation Damage Score 0.574 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that contain MIF4G (middle of eIF4G (MIM 600495)) and/or MA3 domains, such as NOM1, function in protein translation. These domains include binding sites for members of the EIF4A family of ATP-dependent DEAD box RNA helicases (see EIF4A1; MIM 602641) (Simmons et al., 2005 [PubMed 15715967]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Nom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Nom1 APN 5 29446274 missense possibly damaging 0.74
IGL01795:Nom1 APN 5 29446871 missense probably benign 0.06
IGL02308:Nom1 APN 5 29437710 missense probably damaging 1.00
IGL02378:Nom1 APN 5 29451126 nonsense probably null
IGL02506:Nom1 APN 5 29439816 splice site probably benign
R0633:Nom1 UTSW 5 29451100 missense probably damaging 1.00
R0652:Nom1 UTSW 5 29435311 missense probably damaging 1.00
R1571:Nom1 UTSW 5 29442635 nonsense probably null
R1707:Nom1 UTSW 5 29435318 missense probably damaging 0.99
R1852:Nom1 UTSW 5 29446878 missense possibly damaging 0.46
R2025:Nom1 UTSW 5 29446851 missense probably damaging 1.00
R2196:Nom1 UTSW 5 29436021 missense probably benign 0.00
R2207:Nom1 UTSW 5 29439974 missense probably damaging 1.00
R2256:Nom1 UTSW 5 29437752 missense probably damaging 1.00
R2257:Nom1 UTSW 5 29437752 missense probably damaging 1.00
R2680:Nom1 UTSW 5 29443417 missense probably damaging 1.00
R3439:Nom1 UTSW 5 29435617 missense probably benign 0.01
R4291:Nom1 UTSW 5 29446372 critical splice donor site probably null
R4587:Nom1 UTSW 5 29451165 missense possibly damaging 0.91
R5374:Nom1 UTSW 5 29441379 missense probably damaging 1.00
R5761:Nom1 UTSW 5 29437641 missense probably damaging 1.00
R5772:Nom1 UTSW 5 29446875 missense possibly damaging 0.81
R5828:Nom1 UTSW 5 29435126 missense possibly damaging 0.53
R6208:Nom1 UTSW 5 29449619 missense possibly damaging 0.83
R7234:Nom1 UTSW 5 29435453 missense probably benign 0.01
R7476:Nom1 UTSW 5 29442536 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGTTGAGTGAGCCAAACATG -3'
(R):5'- ATAGCCCTTGGTGGAGAGATG -3'

Sequencing Primer
(F):5'- CCAAACATGGCTTCTATAAGTGGGC -3'
(R):5'- CAATTCCTAAGGTAGCCAGGGTAGTC -3'
Posted On2017-03-31