Incidental Mutation 'R0502:Col24a1'
ID47187
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Namecollagen, type XXIV, alpha 1
Synonyms5430404K19Rik
MMRRC Submission 038697-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R0502 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location145292472-145552011 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 145545316 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848]
Predicted Effect probably benign
Transcript: ENSMUST00000029848
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142441
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Ano1 A G 7: 144,597,215 L821P probably damaging Het
Apol10b T A 15: 77,592,149 probably benign Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccar2 A G 14: 70,140,982 S625P probably benign Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cep350 A T 1: 155,900,883 probably null Het
Chd3 A G 11: 69,354,105 V1203A probably damaging Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
D10Wsu102e A G 10: 83,362,056 D42G probably damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dicer1 A T 12: 104,705,060 S984T probably damaging Het
Diexf A T 1: 193,114,828 probably benign Het
Dmbt1 G A 7: 131,097,673 probably null Het
Dnah7b A T 1: 46,219,544 E1965V probably damaging Het
Dpp4 G T 2: 62,364,988 N315K probably damaging Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fat4 T A 3: 39,002,924 S4256R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gpatch4 A G 3: 88,055,365 D295G probably benign Het
Gpbar1 A T 1: 74,279,392 I265F probably benign Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hacl1 A T 14: 31,622,984 probably benign Het
Hnrnpc A G 14: 52,075,172 probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifnar1 T A 16: 91,501,751 C419S probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Itga2 T G 13: 114,845,856 N1038H probably benign Het
Kif16b C T 2: 142,712,155 D908N probably benign Het
Lamc1 A G 1: 153,246,932 probably benign Het
Lrig3 A G 10: 126,008,736 T690A probably damaging Het
Lrp2 T C 2: 69,511,017 K940E probably damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mrps27 G T 13: 99,409,795 probably benign Het
Ncam1 A G 9: 49,569,818 probably benign Het
Olfr30 T C 11: 58,455,314 I212V possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Pbrm1 T G 14: 31,064,820 D631E probably benign Het
Pdc A T 1: 150,328,414 probably benign Het
Pkd1 T C 17: 24,574,792 S1818P probably damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rab35 G A 5: 115,645,664 R170Q probably benign Het
Rerg A T 6: 137,056,307 C123* probably null Het
Ros1 A G 10: 52,194,823 probably benign Het
Siglece A G 7: 43,659,931 Y68H probably damaging Het
Slc28a2 T A 2: 122,458,281 probably null Het
Slc4a11 T C 2: 130,688,157 K234E probably damaging Het
Sqor C T 2: 122,798,050 P158S probably benign Het
Tcerg1 C T 18: 42,522,956 P110S unknown Het
Tm6sf2 T A 8: 70,077,941 Y224N probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Ttll10 T C 4: 156,047,548 probably benign Het
Ubap2l A T 3: 90,009,213 L898Q probably damaging Het
Uggt1 A T 1: 36,159,946 V1207E probably damaging Het
Uhrf2 A G 19: 30,092,776 D775G probably damaging Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn1r87 T G 7: 13,131,656 T235P probably damaging Het
Vmn2r96 T A 17: 18,584,000 M504K probably benign Het
Zdbf2 A T 1: 63,305,290 I943F possibly damaging Het
Zfp78 A G 7: 6,373,158 D22G probably damaging Het
Zfp827 C T 8: 79,179,077 probably null Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145362309 missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145461470 missense probably benign 0.00
IGL01160:Col24a1 APN 3 145507713 missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145314876 missense probably benign 0.07
IGL01409:Col24a1 APN 3 145538564 missense probably benign 0.19
IGL01587:Col24a1 APN 3 145433355 splice site probably null
IGL01666:Col24a1 APN 3 145344686 missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145524263 splice site probably benign
IGL01721:Col24a1 APN 3 145538567 missense probably benign 0.26
IGL01939:Col24a1 APN 3 145315244 missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145524167 splice site probably null
IGL02002:Col24a1 APN 3 145356944 missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145314962 missense probably benign 0.34
IGL02552:Col24a1 APN 3 145474207 missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145314173 missense probably benign
IGL02582:Col24a1 APN 3 145314486 missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145492301 nonsense probably null
IGL02942:Col24a1 APN 3 145541665 missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145538703 critical splice donor site probably null
IGL03108:Col24a1 APN 3 145323401 missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145313983 splice site probably benign
IGL03405:Col24a1 APN 3 145315157 missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145524142 missense possibly damaging 0.94
R0556:Col24a1 UTSW 3 145314728 missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 145293145 missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145314120 missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145328759 missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145460838 missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145389600 critical splice donor site probably null
R1713:Col24a1 UTSW 3 145366869 nonsense probably null
R1854:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145537267 critical splice donor site probably null
R1969:Col24a1 UTSW 3 145314930 missense probably benign 0.03
R2216:Col24a1 UTSW 3 145314981 missense probably benign 0.34
R2290:Col24a1 UTSW 3 145513195 missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145337860 missense probably benign 0.01
R3772:Col24a1 UTSW 3 145545286 missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145461437 missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145524282 nonsense probably null
R4433:Col24a1 UTSW 3 145314383 missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145314383 missense probably benign 0.00
R4972:Col24a1 UTSW 3 145509684 missense probably benign 0.42
R5157:Col24a1 UTSW 3 145345951 nonsense probably null
R5216:Col24a1 UTSW 3 145315310 missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145484678 missense probably benign 0.03
R5334:Col24a1 UTSW 3 145461525 missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145315025 nonsense probably null
R5473:Col24a1 UTSW 3 145537261 missense probably benign 0.41
R5538:Col24a1 UTSW 3 145293121 missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145298827 missense probably benign 0.26
R5648:Col24a1 UTSW 3 145358566 missense probably benign 0.00
R5920:Col24a1 UTSW 3 145428230 missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145314380 missense probably benign 0.00
R6728:Col24a1 UTSW 3 145315196 missense probably benign
R6734:Col24a1 UTSW 3 145508674 missense probably benign 0.06
R6861:Col24a1 UTSW 3 145460834 missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145315046 nonsense probably null
R7001:Col24a1 UTSW 3 145298866 missense probably benign 0.28
R7148:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTCACTGTCTAAACACCCCAAGG -3'
(R):5'- tggcatacacaaacacaGAGATACACAC -3'

Sequencing Primer
(F):5'- GTCTAAACACCCCAAGGTGGAG -3'
(R):5'- tgggagacagaggcagag -3'
Posted On2013-06-12