Incidental Mutation 'R0502:Zfyve9'
ID47188
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Namezinc finger, FYVE domain containing 9
SynonymsMadhip
MMRRC Submission 038697-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R0502 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108637466-108780798 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 108719764 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 40 (L40*)
Ref Sequence ENSEMBL: ENSMUSP00000102269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658] [ENSMUST00000178992]
Predicted Effect probably benign
Transcript: ENSMUST00000042185
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106657
AA Change: L40*
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: L40*

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106658
AA Change: L40*
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: L40*

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178992
SMART Domains Protein: ENSMUSP00000136370
Gene: ENSMUSG00000094958

DomainStartEndE-ValueType
low complexity region 54 74 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 114 148 N/A INTRINSIC
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Ano1 A G 7: 144,597,215 L821P probably damaging Het
Apol10b T A 15: 77,592,149 probably benign Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccar2 A G 14: 70,140,982 S625P probably benign Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cep350 A T 1: 155,900,883 probably null Het
Chd3 A G 11: 69,354,105 V1203A probably damaging Het
Col24a1 A G 3: 145,545,316 probably benign Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
D10Wsu102e A G 10: 83,362,056 D42G probably damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dicer1 A T 12: 104,705,060 S984T probably damaging Het
Diexf A T 1: 193,114,828 probably benign Het
Dmbt1 G A 7: 131,097,673 probably null Het
Dnah7b A T 1: 46,219,544 E1965V probably damaging Het
Dpp4 G T 2: 62,364,988 N315K probably damaging Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fat4 T A 3: 39,002,924 S4256R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gpatch4 A G 3: 88,055,365 D295G probably benign Het
Gpbar1 A T 1: 74,279,392 I265F probably benign Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hacl1 A T 14: 31,622,984 probably benign Het
Hnrnpc A G 14: 52,075,172 probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifnar1 T A 16: 91,501,751 C419S probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Itga2 T G 13: 114,845,856 N1038H probably benign Het
Kif16b C T 2: 142,712,155 D908N probably benign Het
Lamc1 A G 1: 153,246,932 probably benign Het
Lrig3 A G 10: 126,008,736 T690A probably damaging Het
Lrp2 T C 2: 69,511,017 K940E probably damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mrps27 G T 13: 99,409,795 probably benign Het
Ncam1 A G 9: 49,569,818 probably benign Het
Olfr30 T C 11: 58,455,314 I212V possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Pbrm1 T G 14: 31,064,820 D631E probably benign Het
Pdc A T 1: 150,328,414 probably benign Het
Pkd1 T C 17: 24,574,792 S1818P probably damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rab35 G A 5: 115,645,664 R170Q probably benign Het
Rerg A T 6: 137,056,307 C123* probably null Het
Ros1 A G 10: 52,194,823 probably benign Het
Siglece A G 7: 43,659,931 Y68H probably damaging Het
Slc28a2 T A 2: 122,458,281 probably null Het
Slc4a11 T C 2: 130,688,157 K234E probably damaging Het
Sqor C T 2: 122,798,050 P158S probably benign Het
Tcerg1 C T 18: 42,522,956 P110S unknown Het
Tm6sf2 T A 8: 70,077,941 Y224N probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Ttll10 T C 4: 156,047,548 probably benign Het
Ubap2l A T 3: 90,009,213 L898Q probably damaging Het
Uggt1 A T 1: 36,159,946 V1207E probably damaging Het
Uhrf2 A G 19: 30,092,776 D775G probably damaging Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn1r87 T G 7: 13,131,656 T235P probably damaging Het
Vmn2r96 T A 17: 18,584,000 M504K probably benign Het
Zdbf2 A T 1: 63,305,290 I943F possibly damaging Het
Zfp78 A G 7: 6,373,158 D22G probably damaging Het
Zfp827 C T 8: 79,179,077 probably null Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108642107 missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108681064 missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108682151 missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108682260 missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108642092 missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108674523 missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108682223 missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108695825 missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108689209 missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108723799 splice site probably benign
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108680969 missense probably damaging 0.96
R0503:Zfyve9 UTSW 4 108719764 nonsense probably null
R0557:Zfyve9 UTSW 4 108674511 missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108718669 missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108650229 missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108693311 intron probably benign
R1527:Zfyve9 UTSW 4 108695767 critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108684907 critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108660577 nonsense probably null
R1728:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108682295 splice site probably benign
R1983:Zfyve9 UTSW 4 108689189 missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108718603 missense probably benign 0.05
R2050:Zfyve9 UTSW 4 108719303 missense possibly damaging 0.94
R2246:Zfyve9 UTSW 4 108689264 missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108660614 missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108695819 missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108719743 missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108719701 missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108719192 missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108680976 missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108644368 missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108717998 missense possibly damaging 0.70
R4871:Zfyve9 UTSW 4 108680986 missense probably damaging 1.00
R4881:Zfyve9 UTSW 4 108727491 utr 5 prime probably null
R4974:Zfyve9 UTSW 4 108680900 critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108691669 missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108644349 missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108719168 missense probably benign
R5965:Zfyve9 UTSW 4 108691681 missense possibly damaging 0.53
R5996:Zfyve9 UTSW 4 108719360 missense probably benign 0.07
R6315:Zfyve9 UTSW 4 108674488 missense probably damaging 1.00
R6772:Zfyve9 UTSW 4 108639269 missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108644361 missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108650322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCGCACAGAGATGATTCACAG -3'
(R):5'- GGGGACATTTTCTTCAAAGCACAGC -3'

Sequencing Primer
(F):5'- TTCTCGTCTGGCAGACAAG -3'
(R):5'- GTCAGGTAGCCCTAAGTAGCTTT -3'
Posted On2013-06-12