Incidental Mutation 'R5964:Adam15'
ID471929
Institutional Source Beutler Lab
Gene Symbol Adam15
Ensembl Gene ENSMUSG00000028041
Gene Namea disintegrin and metallopeptidase domain 15 (metargidin)
SynonymsMDC15, metargidin
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R5964 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89338542-89349996 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 89343567 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 581 (Q581*)
Ref Sequence ENSEMBL: ENSMUSP00000139147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029676] [ENSMUST00000074582] [ENSMUST00000107446] [ENSMUST00000107448] [ENSMUST00000184651]
Predicted Effect probably null
Transcript: ENSMUST00000029676
AA Change: Q581*
SMART Domains Protein: ENSMUSP00000029676
Gene: ENSMUSG00000028041
AA Change: Q581*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 158 1.2e-14 PFAM
Pfam:Reprolysin_3 208 360 1e-12 PFAM
Pfam:Reprolysin_5 212 394 1.5e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 416 1.6e-54 PFAM
Pfam:Reprolysin_2 257 405 9.9e-12 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074582
AA Change: Q581*
SMART Domains Protein: ENSMUSP00000074167
Gene: ENSMUSG00000028041
AA Change: Q581*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.6e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 2.9e-8 PFAM
Pfam:Reprolysin 214 415 4.2e-56 PFAM
Pfam:Reprolysin_3 238 360 1.7e-14 PFAM
Pfam:Reprolysin_2 254 405 1.1e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 760 813 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107446
SMART Domains Protein: ENSMUSP00000103070
Gene: ENSMUSG00000028041

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 9.9e-22 PFAM
Pfam:Reprolysin_3 209 360 5.9e-15 PFAM
Pfam:Reprolysin_5 212 394 5e-16 PFAM
Pfam:Reprolysin_4 213 410 1e-8 PFAM
Pfam:Reprolysin 214 415 1.4e-56 PFAM
Pfam:Reprolysin_2 253 405 4e-11 PFAM
low complexity region 416 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107448
AA Change: Q581*
SMART Domains Protein: ENSMUSP00000103072
Gene: ENSMUSG00000028041
AA Change: Q581*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.7e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 3e-8 PFAM
Pfam:Reprolysin 214 415 4.4e-56 PFAM
Pfam:Reprolysin_3 238 360 1.8e-14 PFAM
Pfam:Reprolysin_2 254 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 783 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180791
Predicted Effect probably null
Transcript: ENSMUST00000184651
AA Change: Q581*
SMART Domains Protein: ENSMUSP00000139147
Gene: ENSMUSG00000028041
AA Change: Q581*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.9e-21 PFAM
Pfam:Reprolysin_5 212 394 1.7e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 415 4.6e-56 PFAM
Pfam:Reprolysin_3 238 360 1.9e-14 PFAM
Pfam:Reprolysin_2 255 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Meta Mutation Damage Score 0.604 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is prominently expressed in vascular cells, the endocardium, hypertrophic cells in developing bone, and specific areas of hippocampus and cerebellum. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein have increased bone mass resulting from osteoblast proliferation, and exhibit reduced neovascularization in a mouse model for retinopathy. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice develop normally and exhibit normal angiogenesis, but show a resistance to pathological neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Adam15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Adam15 APN 3 89344138 missense probably benign 0.03
IGL01994:Adam15 APN 3 89341505 splice site probably benign
IGL02184:Adam15 APN 3 89345934 splice site probably benign
IGL02501:Adam15 APN 3 89340462 missense possibly damaging 0.82
IGL02821:Adam15 APN 3 89345356 missense probably damaging 1.00
IGL02933:Adam15 APN 3 89343483 missense possibly damaging 0.91
IGL03078:Adam15 APN 3 89345937 splice site probably benign
IGL03185:Adam15 APN 3 89347905 missense probably benign 0.41
PIT4280001:Adam15 UTSW 3 89343978 critical splice acceptor site probably null
PIT4581001:Adam15 UTSW 3 89343832 missense probably benign 0.00
R0559:Adam15 UTSW 3 89343778 missense probably damaging 1.00
R1530:Adam15 UTSW 3 89349830 missense probably damaging 0.99
R1670:Adam15 UTSW 3 89348510 splice site probably benign
R1909:Adam15 UTSW 3 89345330 missense probably benign 0.19
R3110:Adam15 UTSW 3 89347457 missense probably benign 0.10
R3112:Adam15 UTSW 3 89347457 missense probably benign 0.10
R3897:Adam15 UTSW 3 89346938 missense probably benign 0.00
R4058:Adam15 UTSW 3 89347055 missense possibly damaging 0.94
R4573:Adam15 UTSW 3 89345986 missense probably damaging 1.00
R5267:Adam15 UTSW 3 89349899 utr 5 prime probably benign
R5364:Adam15 UTSW 3 89345595 missense probably damaging 1.00
R5801:Adam15 UTSW 3 89342361 missense probably damaging 1.00
R5813:Adam15 UTSW 3 89345828 missense probably benign 0.12
R6218:Adam15 UTSW 3 89343883 missense probably benign 0.00
R6564:Adam15 UTSW 3 89347212 missense possibly damaging 0.56
R6579:Adam15 UTSW 3 89345629 missense probably damaging 1.00
R6834:Adam15 UTSW 3 89340083 missense probably damaging 0.96
R7131:Adam15 UTSW 3 89346980 missense possibly damaging 0.64
R7204:Adam15 UTSW 3 89346937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTCAATCGCCCAGGCTAC -3'
(R):5'- GCCACTTTGCCTCCAAACAG -3'

Sequencing Primer
(F):5'- AGGCTACTCACCAGGCCAG -3'
(R):5'- CAGCCAACACTCGGGGTAATG -3'
Posted On2017-03-31