Incidental Mutation 'R5964:Itgax'
ID 471950
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Name integrin alpha X
Synonyms CD11C (p150) alpha polypeptide, CR4, Cd11c
MMRRC Submission 044149-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R5964 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127728719-127749829 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127739619 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 677 (D677G)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
AlphaFold Q9QXH4
Predicted Effect probably damaging
Transcript: ENSMUST00000033053
AA Change: D677G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: D677G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205408
Meta Mutation Damage Score 0.7696 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,250,874 (GRCm39) Q581* probably null Het
Agl A G 3: 116,587,423 (GRCm39) V44A probably damaging Het
Alpk3 T A 7: 80,742,008 (GRCm39) D608E possibly damaging Het
Aspm C A 1: 139,382,965 (GRCm39) probably benign Het
Bbs2 T C 8: 94,794,995 (GRCm39) N692S probably benign Het
Bend4 A G 5: 67,575,161 (GRCm39) I240T probably benign Het
Casp8 G T 1: 58,872,895 (GRCm39) R277L possibly damaging Het
Ccdc61 A T 7: 18,634,865 (GRCm39) I123N probably damaging Het
Ccr9 T G 9: 123,608,499 (GRCm39) I60M probably benign Het
Cd163 T A 6: 124,303,531 (GRCm39) W1066R probably benign Het
Cd226 A T 18: 89,225,307 (GRCm39) H68L probably benign Het
Cdkn3 T A 14: 47,004,674 (GRCm39) C79S probably null Het
Cnnm1 A T 19: 43,458,162 (GRCm39) E658V probably benign Het
Cog7 T C 7: 121,555,252 (GRCm39) R304G probably damaging Het
Cpt1a T A 19: 3,415,760 (GRCm39) V286E possibly damaging Het
Creg2 C A 1: 39,664,122 (GRCm39) R212L probably benign Het
Cyp26a1 T G 19: 37,688,410 (GRCm39) S311A probably damaging Het
Cyp2b10 T C 7: 25,625,648 (GRCm39) Y484H probably benign Het
Cyp3a44 T A 5: 145,725,277 (GRCm39) Y308F possibly damaging Het
Dlg5 A G 14: 24,214,157 (GRCm39) V744A probably benign Het
Dlgap2 T A 8: 14,777,128 (GRCm39) Y124* probably null Het
Dnah3 T C 7: 119,522,103 (GRCm39) D4030G probably benign Het
Dnah5 A G 15: 28,458,730 (GRCm39) T4456A possibly damaging Het
Dtx2 T A 5: 136,052,553 (GRCm39) V347D probably benign Het
Gigyf2 C T 1: 87,334,889 (GRCm39) T294M probably damaging Het
Gli3 C G 13: 15,900,747 (GRCm39) S1378* probably null Het
Gnao1 G A 8: 94,693,627 (GRCm39) D337N probably benign Het
Gp2 T A 7: 119,048,352 (GRCm39) Q422L probably benign Het
Ifit1 T A 19: 34,625,869 (GRCm39) M335K possibly damaging Het
Ism1 T C 2: 139,520,677 (GRCm39) S30P probably benign Het
Kansl1l G A 1: 66,765,081 (GRCm39) A442V probably damaging Het
Kif13a T C 13: 46,925,000 (GRCm39) I311M probably damaging Het
Lrrc37 A G 11: 103,432,946 (GRCm39) S1232P possibly damaging Het
Lsm14b T A 2: 179,673,218 (GRCm39) S84R probably benign Het
Lzts3 A G 2: 130,478,208 (GRCm39) Y297H probably damaging Het
Map4k3 A G 17: 80,952,191 (GRCm39) I205T probably damaging Het
Matn2 A T 15: 34,410,311 (GRCm39) N501I probably damaging Het
Mctp2 T C 7: 71,752,925 (GRCm39) E776G probably damaging Het
Mex3d A T 10: 80,218,421 (GRCm39) N265K probably damaging Het
Myo5a A G 9: 75,111,115 (GRCm39) T1534A probably benign Het
Ncoa7 T C 10: 30,580,632 (GRCm39) M35V probably damaging Het
Nek4 G A 14: 30,679,036 (GRCm39) probably null Het
Ngrn T C 7: 79,911,681 (GRCm39) probably null Het
Nlrp1a T A 11: 71,013,846 (GRCm39) Q468L probably benign Het
Or11g27 T A 14: 50,771,655 (GRCm39) M262K probably damaging Het
Or5b98 A C 19: 12,931,895 (GRCm39) Q314P probably benign Het
Phtf2 T C 5: 20,980,932 (GRCm39) D433G probably damaging Het
Prdm13 G A 4: 21,683,852 (GRCm39) Q140* probably null Het
Prtg G A 9: 72,799,536 (GRCm39) G778E probably benign Het
Pum3 T C 19: 27,397,451 (GRCm39) E308G probably damaging Het
Pwp1 T G 10: 85,718,750 (GRCm39) F306V probably damaging Het
Rab24 A T 13: 55,469,389 (GRCm39) Y27N probably damaging Het
Rnf215 T C 11: 4,085,898 (GRCm39) F126L probably benign Het
Samd13 A T 3: 146,386,451 (GRCm39) probably benign Het
Serac1 T A 17: 6,115,324 (GRCm39) H213L probably benign Het
Slc45a3 A G 1: 131,905,811 (GRCm39) E278G probably damaging Het
Slit3 C T 11: 35,591,063 (GRCm39) R1292C probably damaging Het
Slx4 A T 16: 3,818,815 (GRCm39) probably null Het
Smarca4 C A 9: 21,558,726 (GRCm39) T631K probably benign Het
Snx16 C T 3: 10,499,541 (GRCm39) R163Q possibly damaging Het
Stk40 T C 4: 126,022,688 (GRCm39) V140A probably damaging Het
Tcf12 A T 9: 71,775,522 (GRCm39) D409E probably damaging Het
Tgfbr2 G T 9: 115,939,323 (GRCm39) T168K possibly damaging Het
Ticam1 G T 17: 56,578,703 (GRCm39) H131N probably damaging Het
Ttn C A 2: 76,660,232 (GRCm39) R7458I possibly damaging Het
Ttn C A 2: 76,543,855 (GRCm39) E31298* probably null Het
Usp7 A G 16: 8,529,966 (GRCm39) V133A possibly damaging Het
Wbp1l C T 19: 46,642,619 (GRCm39) R191* probably null Het
Wdfy4 T C 14: 32,827,968 (GRCm39) E1118G probably damaging Het
Zfp81 G C 17: 33,555,819 (GRCm39) P3A probably damaging Het
Znhit6 A G 3: 145,282,688 (GRCm39) K21R possibly damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 127,734,498 (GRCm39) missense probably damaging 1.00
IGL00325:Itgax APN 7 127,747,481 (GRCm39) missense possibly damaging 0.69
IGL01155:Itgax APN 7 127,744,207 (GRCm39) missense probably benign 0.00
IGL01461:Itgax APN 7 127,734,190 (GRCm39) missense probably damaging 1.00
IGL01508:Itgax APN 7 127,743,990 (GRCm39) missense probably damaging 1.00
IGL01549:Itgax APN 7 127,730,378 (GRCm39) splice site probably null
IGL01864:Itgax APN 7 127,732,935 (GRCm39) missense probably benign 0.00
IGL02094:Itgax APN 7 127,730,645 (GRCm39) missense probably damaging 1.00
IGL02364:Itgax APN 7 127,739,154 (GRCm39) missense possibly damaging 0.89
IGL02969:Itgax APN 7 127,748,295 (GRCm39) missense probably benign
IGL03406:Itgax APN 7 127,748,370 (GRCm39) missense possibly damaging 0.93
Adendritic UTSW 7 127,747,744 (GRCm39) nonsense probably null
PIT4651001:Itgax UTSW 7 127,748,282 (GRCm39) missense probably benign 0.11
R0366:Itgax UTSW 7 127,748,261 (GRCm39) splice site probably benign
R0763:Itgax UTSW 7 127,747,112 (GRCm39) splice site probably benign
R1072:Itgax UTSW 7 127,749,316 (GRCm39) missense probably damaging 0.96
R1659:Itgax UTSW 7 127,730,063 (GRCm39) missense probably benign 0.15
R2019:Itgax UTSW 7 127,747,698 (GRCm39) missense probably benign
R2418:Itgax UTSW 7 127,741,505 (GRCm39) missense probably damaging 0.98
R3027:Itgax UTSW 7 127,747,744 (GRCm39) nonsense probably null
R3846:Itgax UTSW 7 127,732,939 (GRCm39) missense probably damaging 1.00
R3938:Itgax UTSW 7 127,735,445 (GRCm39) missense possibly damaging 0.73
R4021:Itgax UTSW 7 127,732,311 (GRCm39) critical splice donor site probably null
R4027:Itgax UTSW 7 127,740,438 (GRCm39) missense possibly damaging 0.75
R4163:Itgax UTSW 7 127,743,872 (GRCm39) missense probably benign 0.00
R4923:Itgax UTSW 7 127,747,700 (GRCm39) missense probably benign
R5259:Itgax UTSW 7 127,747,450 (GRCm39) missense probably damaging 0.99
R5333:Itgax UTSW 7 127,741,455 (GRCm39) missense probably damaging 1.00
R5347:Itgax UTSW 7 127,740,474 (GRCm39) missense probably benign 0.08
R5679:Itgax UTSW 7 127,734,162 (GRCm39) missense probably benign 0.00
R5725:Itgax UTSW 7 127,747,033 (GRCm39) missense possibly damaging 0.63
R5733:Itgax UTSW 7 127,739,647 (GRCm39) missense probably damaging 0.99
R5750:Itgax UTSW 7 127,743,878 (GRCm39) missense probably benign 0.32
R6004:Itgax UTSW 7 127,730,624 (GRCm39) missense probably damaging 0.96
R6168:Itgax UTSW 7 127,732,269 (GRCm39) missense probably damaging 0.99
R6212:Itgax UTSW 7 127,747,025 (GRCm39) missense probably benign 0.16
R6212:Itgax UTSW 7 127,729,504 (GRCm39) missense possibly damaging 0.52
R6480:Itgax UTSW 7 127,747,771 (GRCm39) missense probably benign 0.12
R6484:Itgax UTSW 7 127,732,890 (GRCm39) missense probably benign 0.13
R6796:Itgax UTSW 7 127,734,236 (GRCm39) missense probably damaging 1.00
R6844:Itgax UTSW 7 127,747,106 (GRCm39) splice site probably null
R7287:Itgax UTSW 7 127,747,677 (GRCm39) missense probably damaging 1.00
R7365:Itgax UTSW 7 127,734,481 (GRCm39) missense probably damaging 1.00
R7421:Itgax UTSW 7 127,739,604 (GRCm39) missense probably damaging 1.00
R7599:Itgax UTSW 7 127,747,262 (GRCm39) missense probably damaging 0.99
R7710:Itgax UTSW 7 127,735,028 (GRCm39) missense probably benign 0.04
R7964:Itgax UTSW 7 127,739,590 (GRCm39) critical splice acceptor site probably null
R8220:Itgax UTSW 7 127,730,090 (GRCm39) missense probably benign 0.00
R8730:Itgax UTSW 7 127,739,066 (GRCm39) critical splice acceptor site probably null
R8742:Itgax UTSW 7 127,743,795 (GRCm39) missense probably benign 0.28
R8812:Itgax UTSW 7 127,732,979 (GRCm39) missense probably damaging 1.00
R8871:Itgax UTSW 7 127,735,223 (GRCm39) missense probably damaging 1.00
R9147:Itgax UTSW 7 127,747,913 (GRCm39) missense possibly damaging 0.74
R9149:Itgax UTSW 7 127,730,641 (GRCm39) missense probably benign 0.01
R9310:Itgax UTSW 7 127,741,432 (GRCm39) nonsense probably null
R9376:Itgax UTSW 7 127,747,935 (GRCm39) missense possibly damaging 0.94
R9377:Itgax UTSW 7 127,732,849 (GRCm39) missense probably benign 0.03
R9641:Itgax UTSW 7 127,741,152 (GRCm39) missense probably damaging 1.00
R9650:Itgax UTSW 7 127,734,935 (GRCm39) missense probably benign 0.24
R9709:Itgax UTSW 7 127,735,500 (GRCm39) missense probably damaging 1.00
X0061:Itgax UTSW 7 127,728,779 (GRCm39) start gained probably benign
Z1176:Itgax UTSW 7 127,744,044 (GRCm39) missense probably benign 0.24
Z1177:Itgax UTSW 7 127,747,234 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAGCAGACACTGAGTGATGC -3'
(R):5'- GGAAAGCTCAGAACATGCTG -3'

Sequencing Primer
(F):5'- GTGATGCCACTGTCTGCC -3'
(R):5'- GAACTTGCTTCCAGTTCCCAAACG -3'
Posted On 2017-03-31