Incidental Mutation 'R5964:Rab24'
ID471971
Institutional Source Beutler Lab
Gene Symbol Rab24
Ensembl Gene ENSMUSG00000034789
Gene NameRAB24, member RAS oncogene family
Synonyms
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5964 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55319743-55321946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55321576 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 27 (Y27N)
Ref Sequence ENSEMBL: ENSMUSP00000046188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021941] [ENSMUST00000021942] [ENSMUST00000035242] [ENSMUST00000099490] [ENSMUST00000224685]
Predicted Effect probably benign
Transcript: ENSMUST00000021941
SMART Domains Protein: ENSMUSP00000021941
Gene: ENSMUSG00000021485

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
HLH 63 115 5.8e-11 SMART
low complexity region 119 138 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021942
SMART Domains Protein: ENSMUSP00000021942
Gene: ENSMUSG00000021486

DomainStartEndE-ValueType
Pfam:PRELI 16 172 1.9e-61 PFAM
coiled coil region 178 215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035242
AA Change: Y27N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046188
Gene: ENSMUSG00000034789
AA Change: Y27N

DomainStartEndE-ValueType
RAB 8 175 2.39e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099490
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224220
Predicted Effect probably benign
Transcript: ENSMUST00000224685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225561
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAB24 is a small GTPase of the Rab subfamily of Ras-related proteins that regulate intracellular protein trafficking (Olkkonen et al., 1993 [PubMed 8126105]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Rab24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0518:Rab24 UTSW 13 55320925 critical splice donor site probably null
R0521:Rab24 UTSW 13 55320925 critical splice donor site probably null
R3871:Rab24 UTSW 13 55321179 missense probably damaging 1.00
R5935:Rab24 UTSW 13 55320530 missense probably damaging 1.00
V1024:Rab24 UTSW 13 55320748 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTACCCAAATGCCCAGAGTC -3'
(R):5'- CAGATTCAGTCGGTAACCCC -3'

Sequencing Primer
(F):5'- ATGCCCAGAGTCACCGTC -3'
(R):5'- CTCTGCAAAGGACGGAGC -3'
Posted On2017-03-31