Incidental Mutation 'R5965:Ric1'
ID472065
Institutional Source Beutler Lab
Gene Symbol Ric1
Ensembl Gene ENSMUSG00000038658
Gene NameRAB6A GEF complex partner 1
SynonymsC030046E11Rik, C130057E09Rik
MMRRC Submission 044150-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.639) question?
Stock #R5965 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29522282-29606829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29570771 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 280 (D280N)
Ref Sequence ENSEMBL: ENSMUSP00000043437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043610]
Predicted Effect probably damaging
Transcript: ENSMUST00000043610
AA Change: D280N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: D280N

DomainStartEndE-ValueType
Blast:WD40 242 278 5e-7 BLAST
SCOP:d1gxra_ 254 379 2e-4 SMART
Blast:WD40 285 334 3e-6 BLAST
Blast:WD40 482 520 5e-6 BLAST
low complexity region 642 653 N/A INTRINSIC
Pfam:RIC1 732 991 1.9e-86 PFAM
low complexity region 1120 1132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160221
Predicted Effect unknown
Transcript: ENSMUST00000162492
AA Change: D208N
SMART Domains Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: D208N

DomainStartEndE-ValueType
Blast:WD40 171 207 4e-7 BLAST
SCOP:d1gxra_ 183 308 2e-4 SMART
Blast:WD40 214 263 2e-6 BLAST
low complexity region 534 545 N/A INTRINSIC
Pfam:RIC1 624 883 1.6e-86 PFAM
low complexity region 1012 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T A 5: 30,205,639 T23S probably benign Het
Armc2 A G 10: 41,922,572 I747T possibly damaging Het
Cacna1c T A 6: 118,602,300 H1729L probably damaging Het
Crebbp A G 16: 4,087,661 probably benign Het
Cyp4f17 T A 17: 32,524,637 M326K probably damaging Het
D230025D16Rik T C 8: 105,234,539 F69L probably damaging Het
Dchs1 T G 7: 105,755,925 D2470A probably damaging Het
Ddhd2 T C 8: 25,735,777 T518A probably damaging Het
Derl2 T C 11: 71,014,552 T109A probably benign Het
Dnah7b T C 1: 46,362,987 L3994P probably damaging Het
Dock10 T C 1: 80,568,744 probably null Het
Dync1h1 T A 12: 110,632,778 S1856T probably benign Het
Ehd2 T C 7: 15,952,074 K358E possibly damaging Het
Enpp2 A G 15: 54,882,971 probably null Het
Esco1 T C 18: 10,593,867 E473G possibly damaging Het
Exoc5 A G 14: 49,034,931 F342S probably damaging Het
Fam186a T A 15: 99,945,097 T1089S probably benign Het
Fam71d T A 12: 78,710,306 N12K unknown Het
Fanca T C 8: 123,316,410 D79G possibly damaging Het
Gabrb2 A G 11: 42,626,869 Y506C probably damaging Het
Galntl6 T C 8: 57,857,531 T379A probably benign Het
Gm34768 A G 2: 11,908,505 noncoding transcript Het
Gps2 A G 11: 69,914,794 E46G possibly damaging Het
Gsdmc T C 15: 63,804,598 probably null Het
Gys1 C T 7: 45,455,339 T666I probably benign Het
Hsd17b11 T A 5: 104,021,785 probably benign Het
Iffo1 T A 6: 125,152,508 probably benign Het
Ighv1-51 T C 12: 115,131,557 noncoding transcript Het
Kansl3 T A 1: 36,345,520 probably null Het
Kdm3a A G 6: 71,621,380 I174T probably benign Het
Klhl26 A T 8: 70,452,731 D95E probably damaging Het
Lair1 T C 7: 4,029,024 D28G possibly damaging Het
Lama3 A G 18: 12,429,887 D489G possibly damaging Het
Lamb3 A T 1: 193,343,460 I1153F probably damaging Het
Lsp1 T A 7: 142,490,424 probably null Het
Man1a A G 10: 53,933,490 probably benign Het
Mcam A C 9: 44,136,628 S57R probably damaging Het
Mrgprf C A 7: 145,307,431 probably benign Het
Nfia T C 4: 98,111,292 *499Q probably null Het
Nmbr C A 10: 14,766,810 R38S probably benign Het
Olfr1126 T G 2: 87,458,037 F291V probably benign Het
Olfr191 T C 16: 59,086,303 Y60C probably damaging Het
Olfr559 C A 7: 102,724,260 V77L probably benign Het
P3h1 C T 4: 119,248,227 H741Y probably benign Het
Parp4 A T 14: 56,624,032 M941L probably benign Het
Pik3c3 C T 18: 30,298,580 T331M probably damaging Het
Prkg1 T C 19: 30,724,156 probably null Het
Qsox2 A T 2: 26,222,221 V103D probably benign Het
Ranbp1 T C 16: 18,245,228 T95A probably damaging Het
Scd1 A G 19: 44,400,140 probably null Het
Serpinb3c A G 1: 107,276,923 I31T probably benign Het
Slc7a11 T A 3: 50,379,144 Y386F probably benign Het
Smtnl2 A T 11: 72,400,453 probably null Het
Snx2 G T 18: 53,194,462 E87* probably null Het
Tars2 A C 3: 95,748,152 probably null Het
Tax1bp1 C A 6: 52,729,332 T106N probably damaging Het
Tcof1 A G 18: 60,833,418 probably null Het
Tenm3 C A 8: 48,228,508 E2680* probably null Het
Thap7 C T 16: 17,530,747 probably benign Het
Thoc6 T A 17: 23,670,868 I23F possibly damaging Het
Tmem185b T G 1: 119,526,564 Y18* probably null Het
Trav6-1 A C 14: 52,638,797 Y58S probably damaging Het
Trbv16 A T 6: 41,152,055 I58F probably benign Het
Ubtfl1 T A 9: 18,409,542 M122K probably benign Het
Vps13a T C 19: 16,619,028 probably null Het
Zdhhc24 T G 19: 4,883,750 D278E probably benign Het
Zfp316 T C 5: 143,264,672 probably null Het
Zfyve9 T C 4: 108,691,681 T769A possibly damaging Het
Znhit6 T A 3: 145,578,348 N96K possibly damaging Het
Other mutations in Ric1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Ric1 APN 19 29595362 missense probably damaging 1.00
IGL00902:Ric1 APN 19 29567231 missense probably benign 0.05
IGL01405:Ric1 APN 19 29567370 splice site probably benign
IGL01629:Ric1 APN 19 29603981 missense probably benign 0.02
IGL01688:Ric1 APN 19 29577614 missense probably benign 0.00
IGL01966:Ric1 APN 19 29595563 missense probably benign 0.33
IGL02123:Ric1 APN 19 29594800 missense probably benign
IGL02590:Ric1 APN 19 29567481 splice site probably benign
IGL02655:Ric1 APN 19 29595451 missense probably damaging 1.00
IGL02699:Ric1 APN 19 29522557 missense possibly damaging 0.51
IGL02718:Ric1 APN 19 29533240 missense probably damaging 1.00
IGL03026:Ric1 APN 19 29599833 missense probably benign 0.02
IGL03142:Ric1 APN 19 29600980 missense possibly damaging 0.89
R0109:Ric1 UTSW 19 29586677 synonymous silent
R0336:Ric1 UTSW 19 29587793 missense probably damaging 0.96
R0362:Ric1 UTSW 19 29601011 critical splice donor site probably null
R0676:Ric1 UTSW 19 29577647 missense probably benign
R0734:Ric1 UTSW 19 29594818 missense possibly damaging 0.66
R1004:Ric1 UTSW 19 29602357 missense probably benign 0.00
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1216:Ric1 UTSW 19 29577735 missense probably benign 0.00
R1493:Ric1 UTSW 19 29579849 missense probably benign
R1848:Ric1 UTSW 19 29600813 splice site probably null
R1872:Ric1 UTSW 19 29602668 missense probably benign 0.32
R1942:Ric1 UTSW 19 29601016 splice site probably benign
R2143:Ric1 UTSW 19 29533252 missense probably damaging 1.00
R2143:Ric1 UTSW 19 29533253 missense probably damaging 0.96
R2679:Ric1 UTSW 19 29604030 missense probably benign
R2878:Ric1 UTSW 19 29602330 missense possibly damaging 0.77
R2970:Ric1 UTSW 19 29577718 missense probably benign 0.15
R3420:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3421:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3940:Ric1 UTSW 19 29570762 missense probably damaging 1.00
R4004:Ric1 UTSW 19 29579801 missense probably benign 0.44
R4225:Ric1 UTSW 19 29602731 missense possibly damaging 0.89
R4280:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4283:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4516:Ric1 UTSW 19 29570765 missense probably benign 0.17
R4702:Ric1 UTSW 19 29598017 missense possibly damaging 0.85
R4824:Ric1 UTSW 19 29585842 missense probably damaging 1.00
R4835:Ric1 UTSW 19 29595536 missense possibly damaging 0.80
R5860:Ric1 UTSW 19 29599845 missense possibly damaging 0.91
R5883:Ric1 UTSW 19 29595989 missense probably damaging 1.00
R6141:Ric1 UTSW 19 29595442 missense probably damaging 1.00
R6236:Ric1 UTSW 19 29595426 missense possibly damaging 0.91
R6271:Ric1 UTSW 19 29567365 splice site probably null
R6345:Ric1 UTSW 19 29604085 missense probably benign 0.09
R6371:Ric1 UTSW 19 29562026 missense probably benign 0.35
R6547:Ric1 UTSW 19 29594826 missense probably damaging 1.00
R6924:Ric1 UTSW 19 29569388 missense probably damaging 0.98
R6969:Ric1 UTSW 19 29585782 missense probably damaging 1.00
R6970:Ric1 UTSW 19 29587772 missense probably damaging 1.00
R6993:Ric1 UTSW 19 29586613 missense probably damaging 1.00
R7296:Ric1 UTSW 19 29584578 critical splice donor site probably null
R7434:Ric1 UTSW 19 29574780 missense probably damaging 1.00
X0064:Ric1 UTSW 19 29587802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCCTAAAGCAAGCAGAAG -3'
(R):5'- CACTGCCACAAGCCTTTATG -3'

Sequencing Primer
(F):5'- CCCAGGTTGATGCATATCGCTAAAG -3'
(R):5'- CTGCCACAAGCCTTTATGTGTAAGG -3'
Posted On2017-03-31