Incidental Mutation 'R5966:Igfn1'
ID472071
Institutional Source Beutler Lab
Gene Symbol Igfn1
Ensembl Gene ENSMUSG00000051985
Gene Nameimmunoglobulin-like and fibronectin type III domain containing 1
Synonyms9830123M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R5966 (G1)
Quality Score172
Status Validated
Chromosome1
Chromosomal Location135953578-136006342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135965414 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2099 (V2099A)
Ref Sequence ENSEMBL: ENSMUSP00000129680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166193]
Predicted Effect unknown
Transcript: ENSMUST00000124134
AA Change: V483A
SMART Domains Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985
AA Change: V483A

DomainStartEndE-ValueType
IG 73 159 1.29e-6 SMART
IG_like 258 344 5.45e1 SMART
IG 354 435 1.79e0 SMART
IG 445 524 3.54e-4 SMART
IG 538 624 4.86e-2 SMART
FN3 627 711 3.99e-10 SMART
FN3 727 810 9.1e-14 SMART
FN3 828 911 1.5e-14 SMART
IG 938 1021 6.41e-2 SMART
FN3 1024 1106 3.2e-9 SMART
IGc2 1152 1219 4.89e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140703
Predicted Effect probably damaging
Transcript: ENSMUST00000166193
AA Change: V2099A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: V2099A

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
IG 193 279 1.29e-6 SMART
PDB:2LHU|A 302 365 8e-7 PDB
IG_like 378 464 5.45e1 SMART
IG 474 555 1.79e0 SMART
low complexity region 724 739 N/A INTRINSIC
internal_repeat_2 838 1006 9.98e-5 PROSPERO
low complexity region 1067 1084 N/A INTRINSIC
internal_repeat_2 1812 1967 9.98e-5 PROSPERO
Pfam:I-set 2054 2139 6.2e-8 PFAM
IG 2153 2239 4.86e-2 SMART
FN3 2242 2326 3.99e-10 SMART
FN3 2342 2425 9.1e-14 SMART
FN3 2443 2526 1.5e-14 SMART
IG 2553 2636 6.41e-2 SMART
FN3 2639 2721 3.2e-9 SMART
IGc2 2767 2834 4.89e-7 SMART
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 94% (79/84)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,571,687 Y214C probably damaging Het
A930009A15Rik A T 10: 115,579,812 probably benign Het
Acaa2 T C 18: 74,804,152 L369S probably damaging Het
Akna A G 4: 63,394,903 S328P probably damaging Het
Apc A G 18: 34,221,087 probably benign Het
Brca2 C T 5: 150,543,251 T2160I probably damaging Het
Camsap2 A G 1: 136,276,592 S1251P probably damaging Het
Ccdc110 A G 8: 45,942,536 E488G probably damaging Het
Ccdc158 T A 5: 92,650,049 I411F probably damaging Het
Cd163 C T 6: 124,320,636 Q914* probably null Het
Cd22 T C 7: 30,866,658 D827G probably damaging Het
Ces1e A G 8: 93,219,373 probably null Het
Col14a1 T C 15: 55,452,383 probably null Het
Csmd3 T A 15: 47,849,739 D1509V probably damaging Het
Ddx51 A G 5: 110,656,851 D543G probably damaging Het
Diaph3 T A 14: 86,984,825 I408F probably damaging Het
Dld G A 12: 31,340,326 P213L probably damaging Het
Dnah6 T C 6: 73,060,279 T3327A probably benign Het
Dnttip2 T A 3: 122,285,168 probably benign Het
Dock10 T C 1: 80,568,508 E791G possibly damaging Het
Ehd3 G T 17: 73,827,361 W238C probably damaging Het
Ehd3 T G 17: 73,827,366 L240R probably damaging Het
Ep400 A G 5: 110,676,900 V2357A unknown Het
Fam20c T C 5: 138,756,177 V181A probably damaging Het
Gm4781 T C 10: 100,396,952 noncoding transcript Het
Gpatch8 A T 11: 102,480,232 S827T unknown Het
Grm3 A T 5: 9,511,930 I640N probably damaging Het
Gstm7 A G 3: 107,931,431 probably benign Het
Hdac7 G T 15: 97,802,491 H572Q probably damaging Het
Ift140 C T 17: 25,094,761 Q1389* probably null Het
Ik A G 18: 36,755,478 N443S possibly damaging Het
Impact A G 18: 12,990,544 K315E probably benign Het
Insr C A 8: 3,258,697 R113L probably benign Het
Jak2 T A 19: 29,283,554 Y317N possibly damaging Het
Kif18a T A 2: 109,292,066 V162E probably damaging Het
L3mbtl3 A G 10: 26,331,864 V319A unknown Het
Lepr T C 4: 101,792,127 probably benign Het
Lmo7 C T 14: 101,900,502 T647I possibly damaging Het
Mindy3 C T 2: 12,401,043 R147Q probably benign Het
Mtr T C 13: 12,215,567 probably null Het
Muc4 A T 16: 32,756,278 probably benign Het
Nrip1 G A 16: 76,293,583 T362M possibly damaging Het
Olfr1175-ps A G 2: 88,322,878 S276P probably benign Het
Olfr346 G T 2: 36,688,062 R20L probably null Het
Olfr357 T C 2: 36,996,945 I45T possibly damaging Het
Ovol1 G A 19: 5,551,602 R131C probably damaging Het
Pcca T C 14: 122,668,586 V323A probably damaging Het
Pcdhb14 A T 18: 37,448,242 M134L probably benign Het
Pecam1 G A 11: 106,691,061 T252M probably benign Het
Rnd3 T A 2: 51,132,524 I169F probably damaging Het
Rnmt T A 18: 68,311,618 D219E probably benign Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Ryr2 G T 13: 11,662,238 C3242* probably null Het
Smurf2 G T 11: 106,875,901 R31S possibly damaging Het
Sptbn1 A G 11: 30,124,873 I1333T probably damaging Het
Stard9 G A 2: 120,697,099 C1279Y probably damaging Het
Sugp2 T C 8: 70,252,103 probably null Het
Sulf1 A T 1: 12,859,412 D301V probably benign Het
Tbcd G T 11: 121,601,911 probably benign Het
Tlr11 T C 14: 50,362,255 I566T probably benign Het
Tm9sf2 T A 14: 122,137,509 probably benign Het
Tnfaip8l1 T C 17: 56,171,799 F30L probably benign Het
Trav15-2-dv6-2 T A 14: 53,649,976 C118S probably damaging Het
Ttc13 A G 8: 124,682,220 probably benign Het
Ubqln3 A T 7: 104,141,699 S395T probably benign Het
Urb2 A G 8: 124,028,088 D178G probably benign Het
Usf3 A G 16: 44,220,859 I1901V probably benign Het
Vmn1r173 A T 7: 23,702,687 I116F probably benign Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wfikkn2 C T 11: 94,238,862 R151H probably damaging Het
Other mutations in Igfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Igfn1 APN 1 135966726 missense probably damaging 1.00
IGL02299:Igfn1 APN 1 135954017
Bounty UTSW 1 135976917 critical splice donor site probably null
R0144:Igfn1 UTSW 1 135962013 missense probably damaging 0.99
R0190:Igfn1 UTSW 1 135962052 missense probably damaging 1.00
R0350:Igfn1 UTSW 1 135956767 nonsense probably null
R0413:Igfn1 UTSW 1 135967596 missense probably benign 0.23
R0504:Igfn1 UTSW 1 135968529 missense probably benign 0.00
R0606:Igfn1 UTSW 1 135959901 missense probably damaging 1.00
R0681:Igfn1 UTSW 1 135963853 missense possibly damaging 0.88
R0825:Igfn1 UTSW 1 135963126 missense probably damaging 1.00
R0839:Igfn1 UTSW 1 135954680 missense probably damaging 1.00
R1066:Igfn1 UTSW 1 135970725 missense probably benign
R1078:Igfn1 UTSW 1 135974847 missense probably damaging 1.00
R1224:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R1569:Igfn1 UTSW 1 135969033 missense probably benign
R1626:Igfn1 UTSW 1 135968967 missense probably benign 0.29
R1663:Igfn1 UTSW 1 135968308 missense probably benign 0.15
R1677:Igfn1 UTSW 1 135971101 missense probably damaging 0.99
R1709:Igfn1 UTSW 1 135955573 missense probably benign 0.24
R1728:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1728:Igfn1 UTSW 1 135968199 missense probably benign
R1728:Igfn1 UTSW 1 135970411 missense probably benign
R1728:Igfn1 UTSW 1 135972127 missense probably benign
R1728:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1728:Igfn1 UTSW 1 135982475 missense probably benign
R1728:Igfn1 UTSW 1 135998625 missense probably benign
R1728:Igfn1 UTSW 1 135998683 missense unknown
R1729:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135968199 missense probably benign
R1729:Igfn1 UTSW 1 135970411 missense probably benign
R1729:Igfn1 UTSW 1 135972127 missense probably benign
R1729:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1729:Igfn1 UTSW 1 135982475 missense probably benign
R1729:Igfn1 UTSW 1 135998625 missense probably benign
R1729:Igfn1 UTSW 1 135998683 missense unknown
R1730:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1730:Igfn1 UTSW 1 135968199 missense probably benign
R1730:Igfn1 UTSW 1 135970411 missense probably benign
R1730:Igfn1 UTSW 1 135972127 missense probably benign
R1730:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1730:Igfn1 UTSW 1 135982475 missense probably benign
R1730:Igfn1 UTSW 1 135998625 missense probably benign
R1730:Igfn1 UTSW 1 135998683 missense unknown
R1739:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1739:Igfn1 UTSW 1 135968199 missense probably benign
R1739:Igfn1 UTSW 1 135970411 missense probably benign
R1739:Igfn1 UTSW 1 135972127 missense probably benign
R1739:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1739:Igfn1 UTSW 1 135982475 missense probably benign
R1739:Igfn1 UTSW 1 135998625 missense probably benign
R1739:Igfn1 UTSW 1 135998683 missense unknown
R1746:Igfn1 UTSW 1 135969823 missense possibly damaging 0.88
R1762:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1762:Igfn1 UTSW 1 135968199 missense probably benign
R1762:Igfn1 UTSW 1 135970411 missense probably benign
R1762:Igfn1 UTSW 1 135972127 missense probably benign
R1762:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1762:Igfn1 UTSW 1 135982475 missense probably benign
R1762:Igfn1 UTSW 1 135998625 missense probably benign
R1762:Igfn1 UTSW 1 135998683 missense unknown
R1783:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1783:Igfn1 UTSW 1 135968199 missense probably benign
R1783:Igfn1 UTSW 1 135970411 missense probably benign
R1783:Igfn1 UTSW 1 135972127 missense probably benign
R1783:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1783:Igfn1 UTSW 1 135982475 missense probably benign
R1783:Igfn1 UTSW 1 135998625 missense probably benign
R1783:Igfn1 UTSW 1 135998683 missense unknown
R1784:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1784:Igfn1 UTSW 1 135968199 missense probably benign
R1784:Igfn1 UTSW 1 135970411 missense probably benign
R1784:Igfn1 UTSW 1 135972127 missense probably benign
R1784:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1784:Igfn1 UTSW 1 135982475 missense probably benign
R1784:Igfn1 UTSW 1 135998625 missense probably benign
R1784:Igfn1 UTSW 1 135998683 missense unknown
R1785:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1785:Igfn1 UTSW 1 135968199 missense probably benign
R1785:Igfn1 UTSW 1 135970411 missense probably benign
R1785:Igfn1 UTSW 1 135972127 missense probably benign
R1785:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1785:Igfn1 UTSW 1 135982475 missense probably benign
R1785:Igfn1 UTSW 1 135998625 missense probably benign
R1785:Igfn1 UTSW 1 135998683 missense unknown
R1847:Igfn1 UTSW 1 135969388 missense probably benign
R1866:Igfn1 UTSW 1 135974868 intron probably null
R1921:Igfn1 UTSW 1 135966063 critical splice donor site probably null
R1984:Igfn1 UTSW 1 135962044 missense probably benign 0.39
R2049:Igfn1 UTSW 1 135970638 missense probably benign
R2049:Igfn1 UTSW 1 135974852 splice site probably benign
R2098:Igfn1 UTSW 1 135978305 missense probably damaging 1.00
R2130:Igfn1 UTSW 1 135974852 splice site probably benign
R2141:Igfn1 UTSW 1 135974852 splice site probably benign
R2276:Igfn1 UTSW 1 135964741 missense probably damaging 0.98
R2425:Igfn1 UTSW 1 135963102 missense probably damaging 1.00
R2483:Igfn1 UTSW 1 135969537 missense probably benign
R2504:Igfn1 UTSW 1 135969316 missense probably benign 0.07
R3109:Igfn1 UTSW 1 135997848 missense probably benign 0.12
R3421:Igfn1 UTSW 1 135976917 critical splice donor site probably null
R3423:Igfn1 UTSW 1 135998641 missense probably benign 0.01
R3705:Igfn1 UTSW 1 135968409 missense probably benign
R3871:Igfn1 UTSW 1 135968836 missense probably benign 0.03
R3875:Igfn1 UTSW 1 135954614 missense probably damaging 1.00
R3953:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3955:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3957:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3965:Igfn1 UTSW 1 135967819 missense probably benign
R4006:Igfn1 UTSW 1 135982362 splice site probably null
R4058:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4059:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4370:Igfn1 UTSW 1 135968106 missense probably benign 0.00
R4380:Igfn1 UTSW 1 135967771 missense probably benign 0.00
R4495:Igfn1 UTSW 1 135969678 missense possibly damaging 0.79
R4628:Igfn1 UTSW 1 135959730 missense possibly damaging 0.47
R4672:Igfn1 UTSW 1 135965369 missense possibly damaging 0.72
R4682:Igfn1 UTSW 1 135998625 missense probably benign
R4702:Igfn1 UTSW 1 135967209 missense possibly damaging 0.71
R4744:Igfn1 UTSW 1 135982458 missense probably benign 0.07
R4777:Igfn1 UTSW 1 135954862 missense probably benign
R4806:Igfn1 UTSW 1 135967357 missense probably benign 0.01
R4840:Igfn1 UTSW 1 135968040 missense probably benign 0.00
R4894:Igfn1 UTSW 1 135954782 missense probably damaging 1.00
R4998:Igfn1 UTSW 1 135954666 missense probably damaging 1.00
R5092:Igfn1 UTSW 1 135964826 missense probably benign
R5108:Igfn1 UTSW 1 135982441 missense probably benign
R5120:Igfn1 UTSW 1 135973502 missense possibly damaging 0.93
R5127:Igfn1 UTSW 1 135959896 missense probably damaging 1.00
R5231:Igfn1 UTSW 1 135966736 missense probably benign 0.26
R5286:Igfn1 UTSW 1 135967861 missense probably benign 0.10
R5307:Igfn1 UTSW 1 135964938 missense probably damaging 1.00
R5380:Igfn1 UTSW 1 135966087 missense probably damaging 1.00
R5553:Igfn1 UTSW 1 135967884 missense probably damaging 1.00
R5660:Igfn1 UTSW 1 135970414 missense probably benign 0.01
R5779:Igfn1 UTSW 1 135966840 missense probably benign 0.16
R5818:Igfn1 UTSW 1 135966126 missense possibly damaging 0.72
R5832:Igfn1 UTSW 1 135974795 missense probably damaging 0.96
R5933:Igfn1 UTSW 1 135970603 nonsense probably null
R6116:Igfn1 UTSW 1 135970467 missense probably benign 0.00
R6297:Igfn1 UTSW 1 135964661 critical splice donor site probably null
R6652:Igfn1 UTSW 1 135963871 missense probably damaging 1.00
R6737:Igfn1 UTSW 1 135969867 missense probably benign
R6816:Igfn1 UTSW 1 135959728 missense probably benign 0.02
R6886:Igfn1 UTSW 1 135973460 missense probably damaging 1.00
R6888:Igfn1 UTSW 1 135982480 missense probably benign 0.33
R6975:Igfn1 UTSW 1 135968445 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTGAAGGATTCAGGGCTTC -3'
(R):5'- TAACAGCGCTCATCTCCTAGG -3'

Sequencing Primer
(F):5'- CCATAGAGGAACATTTCACCTGGTG -3'
(R):5'- CTCATCTCCTAGGGCTGATTTGAGAG -3'
Posted On2017-03-31