Incidental Mutation 'R5966:Olfr357'
ID472075
Institutional Source Beutler Lab
Gene Symbol Olfr357
Ensembl Gene ENSMUSG00000055838
Gene Nameolfactory receptor 357
SynonymsGA_x6K02T2NLDC-33688556-33689482, MOR138-3
MMRRC Submission 044151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5966 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36993827-37001847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36996945 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 45 (I45T)
Ref Sequence ENSEMBL: ENSMUSP00000149727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069578] [ENSMUST00000213218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069578
AA Change: I45T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066272
Gene: ENSMUSG00000055838
AA Change: I45T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.6e-53 PFAM
Pfam:7tm_1 41 290 1.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213218
AA Change: I45T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,571,687 Y214C probably damaging Het
A930009A15Rik A T 10: 115,579,812 probably benign Het
Acaa2 T C 18: 74,804,152 L369S probably damaging Het
Akna A G 4: 63,394,903 S328P probably damaging Het
Apc A G 18: 34,221,087 probably benign Het
Brca2 C T 5: 150,543,251 T2160I probably damaging Het
Camsap2 A G 1: 136,276,592 S1251P probably damaging Het
Ccdc110 A G 8: 45,942,536 E488G probably damaging Het
Ccdc158 T A 5: 92,650,049 I411F probably damaging Het
Cd163 C T 6: 124,320,636 Q914* probably null Het
Cd22 T C 7: 30,866,658 D827G probably damaging Het
Ces1e A G 8: 93,219,373 probably null Het
Col14a1 T C 15: 55,452,383 probably null Het
Csmd3 T A 15: 47,849,739 D1509V probably damaging Het
Ddx51 A G 5: 110,656,851 D543G probably damaging Het
Diaph3 T A 14: 86,984,825 I408F probably damaging Het
Dld G A 12: 31,340,326 P213L probably damaging Het
Dnah6 T C 6: 73,060,279 T3327A probably benign Het
Dnttip2 T A 3: 122,285,168 probably benign Het
Dock10 T C 1: 80,568,508 E791G possibly damaging Het
Ehd3 G T 17: 73,827,361 W238C probably damaging Het
Ehd3 T G 17: 73,827,366 L240R probably damaging Het
Ep400 A G 5: 110,676,900 V2357A unknown Het
Fam20c T C 5: 138,756,177 V181A probably damaging Het
Gm4781 T C 10: 100,396,952 noncoding transcript Het
Gpatch8 A T 11: 102,480,232 S827T unknown Het
Grm3 A T 5: 9,511,930 I640N probably damaging Het
Gstm7 A G 3: 107,931,431 probably benign Het
Hdac7 G T 15: 97,802,491 H572Q probably damaging Het
Ift140 C T 17: 25,094,761 Q1389* probably null Het
Igfn1 A G 1: 135,965,414 V2099A probably damaging Het
Ik A G 18: 36,755,478 N443S possibly damaging Het
Impact A G 18: 12,990,544 K315E probably benign Het
Insr C A 8: 3,258,697 R113L probably benign Het
Jak2 T A 19: 29,283,554 Y317N possibly damaging Het
Kif18a T A 2: 109,292,066 V162E probably damaging Het
L3mbtl3 A G 10: 26,331,864 V319A unknown Het
Lepr T C 4: 101,792,127 probably benign Het
Lmo7 C T 14: 101,900,502 T647I possibly damaging Het
Mindy3 C T 2: 12,401,043 R147Q probably benign Het
Mtr T C 13: 12,215,567 probably null Het
Muc4 A T 16: 32,756,278 probably benign Het
Nrip1 G A 16: 76,293,583 T362M possibly damaging Het
Olfr1175-ps A G 2: 88,322,878 S276P probably benign Het
Olfr346 G T 2: 36,688,062 R20L probably null Het
Ovol1 G A 19: 5,551,602 R131C probably damaging Het
Pcca T C 14: 122,668,586 V323A probably damaging Het
Pcdhb14 A T 18: 37,448,242 M134L probably benign Het
Pecam1 G A 11: 106,691,061 T252M probably benign Het
Rnd3 T A 2: 51,132,524 I169F probably damaging Het
Rnmt T A 18: 68,311,618 D219E probably benign Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Ryr2 G T 13: 11,662,238 C3242* probably null Het
Smurf2 G T 11: 106,875,901 R31S possibly damaging Het
Sptbn1 A G 11: 30,124,873 I1333T probably damaging Het
Stard9 G A 2: 120,697,099 C1279Y probably damaging Het
Sugp2 T C 8: 70,252,103 probably null Het
Sulf1 A T 1: 12,859,412 D301V probably benign Het
Tbcd G T 11: 121,601,911 probably benign Het
Tlr11 T C 14: 50,362,255 I566T probably benign Het
Tm9sf2 T A 14: 122,137,509 probably benign Het
Tnfaip8l1 T C 17: 56,171,799 F30L probably benign Het
Trav15-2-dv6-2 T A 14: 53,649,976 C118S probably damaging Het
Ttc13 A G 8: 124,682,220 probably benign Het
Ubqln3 A T 7: 104,141,699 S395T probably benign Het
Urb2 A G 8: 124,028,088 D178G probably benign Het
Usf3 A G 16: 44,220,859 I1901V probably benign Het
Vmn1r173 A T 7: 23,702,687 I116F probably benign Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wfikkn2 C T 11: 94,238,862 R151H probably damaging Het
Other mutations in Olfr357
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Olfr357 APN 2 36996943 missense probably benign
IGL02043:Olfr357 APN 2 36997465 nonsense probably null
IGL02277:Olfr357 APN 2 36997184 unclassified probably null
IGL03037:Olfr357 APN 2 36997548 missense probably benign 0.00
IGL03378:Olfr357 APN 2 36996903 missense probably damaging 1.00
R0212:Olfr357 UTSW 2 36997323 missense probably damaging 0.98
R0212:Olfr357 UTSW 2 36997632 missense possibly damaging 0.92
R1334:Olfr357 UTSW 2 36996860 missense probably benign 0.27
R1704:Olfr357 UTSW 2 36996884 missense probably benign 0.34
R2020:Olfr357 UTSW 2 36997652 missense possibly damaging 0.85
R2364:Olfr357 UTSW 2 36997565 missense probably damaging 1.00
R4700:Olfr357 UTSW 2 36997503 missense probably benign 0.01
R5105:Olfr357 UTSW 2 36997457 unclassified probably null
R5234:Olfr357 UTSW 2 36997095 missense probably benign
R5557:Olfr357 UTSW 2 36997346 missense probably damaging 1.00
R6480:Olfr357 UTSW 2 36996995 missense probably benign 0.00
R7046:Olfr357 UTSW 2 36997161 missense probably benign 0.39
R7350:Olfr357 UTSW 2 36996861 missense possibly damaging 0.84
Z1088:Olfr357 UTSW 2 36997705 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGTGAGCATTACTAAGTAGTCTGC -3'
(R):5'- TCCATGGCTGCAAAGCAAATG -3'

Sequencing Primer
(F):5'- GTCTGCTCATATTTTCAAGGACTG -3'
(R):5'- TGAAGAAATATGTTTGGGCTAAGC -3'
Posted On2017-03-31