Incidental Mutation 'R5966:Gstm7'
ID472080
Institutional Source Beutler Lab
Gene Symbol Gstm7
Ensembl Gene ENSMUSG00000004035
Gene Nameglutathione S-transferase, mu 7
SynonymsCd203c, 0610005A07Rik
MMRRC Submission 044151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5966 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107926334-107931817 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 107931431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004137] [ENSMUST00000106687] [ENSMUST00000106688] [ENSMUST00000124215] [ENSMUST00000133947]
Predicted Effect probably benign
Transcript: ENSMUST00000004137
SMART Domains Protein: ENSMUSP00000004137
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.2e-23 PFAM
Pfam:GST_C_3 42 190 1.2e-9 PFAM
Pfam:GST_C 104 191 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106687
SMART Domains Protein: ENSMUSP00000102298
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N 3 82 6.8e-24 PFAM
Pfam:GST_N_3 11 93 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106688
SMART Domains Protein: ENSMUSP00000102299
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N_3 4 89 8.8e-7 PFAM
Pfam:GST_N 5 78 4.2e-19 PFAM
Pfam:GST_C 100 188 5.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124215
SMART Domains Protein: ENSMUSP00000118707
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N 1 72 8.6e-20 PFAM
Pfam:GST_N_3 3 83 4e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133947
AA Change: V40A
SMART Domains Protein: ENSMUSP00000122567
Gene: ENSMUSG00000004035
AA Change: V40A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GST_N 45 123 2.6e-19 PFAM
Pfam:GST_N_3 54 134 1.4e-6 PFAM
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,571,687 Y214C probably damaging Het
A930009A15Rik A T 10: 115,579,812 probably benign Het
Acaa2 T C 18: 74,804,152 L369S probably damaging Het
Akna A G 4: 63,394,903 S328P probably damaging Het
Apc A G 18: 34,221,087 probably benign Het
Brca2 C T 5: 150,543,251 T2160I probably damaging Het
Camsap2 A G 1: 136,276,592 S1251P probably damaging Het
Ccdc110 A G 8: 45,942,536 E488G probably damaging Het
Ccdc158 T A 5: 92,650,049 I411F probably damaging Het
Cd163 C T 6: 124,320,636 Q914* probably null Het
Cd22 T C 7: 30,866,658 D827G probably damaging Het
Ces1e A G 8: 93,219,373 probably null Het
Col14a1 T C 15: 55,452,383 probably null Het
Csmd3 T A 15: 47,849,739 D1509V probably damaging Het
Ddx51 A G 5: 110,656,851 D543G probably damaging Het
Diaph3 T A 14: 86,984,825 I408F probably damaging Het
Dld G A 12: 31,340,326 P213L probably damaging Het
Dnah6 T C 6: 73,060,279 T3327A probably benign Het
Dnttip2 T A 3: 122,285,168 probably benign Het
Dock10 T C 1: 80,568,508 E791G possibly damaging Het
Ehd3 G T 17: 73,827,361 W238C probably damaging Het
Ehd3 T G 17: 73,827,366 L240R probably damaging Het
Ep400 A G 5: 110,676,900 V2357A unknown Het
Fam20c T C 5: 138,756,177 V181A probably damaging Het
Gm4781 T C 10: 100,396,952 noncoding transcript Het
Gpatch8 A T 11: 102,480,232 S827T unknown Het
Grm3 A T 5: 9,511,930 I640N probably damaging Het
Hdac7 G T 15: 97,802,491 H572Q probably damaging Het
Ift140 C T 17: 25,094,761 Q1389* probably null Het
Igfn1 A G 1: 135,965,414 V2099A probably damaging Het
Ik A G 18: 36,755,478 N443S possibly damaging Het
Impact A G 18: 12,990,544 K315E probably benign Het
Insr C A 8: 3,258,697 R113L probably benign Het
Jak2 T A 19: 29,283,554 Y317N possibly damaging Het
Kif18a T A 2: 109,292,066 V162E probably damaging Het
L3mbtl3 A G 10: 26,331,864 V319A unknown Het
Lepr T C 4: 101,792,127 probably benign Het
Lmo7 C T 14: 101,900,502 T647I possibly damaging Het
Mindy3 C T 2: 12,401,043 R147Q probably benign Het
Mtr T C 13: 12,215,567 probably null Het
Muc4 A T 16: 32,756,278 probably benign Het
Nrip1 G A 16: 76,293,583 T362M possibly damaging Het
Olfr1175-ps A G 2: 88,322,878 S276P probably benign Het
Olfr346 G T 2: 36,688,062 R20L probably null Het
Olfr357 T C 2: 36,996,945 I45T possibly damaging Het
Ovol1 G A 19: 5,551,602 R131C probably damaging Het
Pcca T C 14: 122,668,586 V323A probably damaging Het
Pcdhb14 A T 18: 37,448,242 M134L probably benign Het
Pecam1 G A 11: 106,691,061 T252M probably benign Het
Rnd3 T A 2: 51,132,524 I169F probably damaging Het
Rnmt T A 18: 68,311,618 D219E probably benign Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Ryr2 G T 13: 11,662,238 C3242* probably null Het
Smurf2 G T 11: 106,875,901 R31S possibly damaging Het
Sptbn1 A G 11: 30,124,873 I1333T probably damaging Het
Stard9 G A 2: 120,697,099 C1279Y probably damaging Het
Sugp2 T C 8: 70,252,103 probably null Het
Sulf1 A T 1: 12,859,412 D301V probably benign Het
Tbcd G T 11: 121,601,911 probably benign Het
Tlr11 T C 14: 50,362,255 I566T probably benign Het
Tm9sf2 T A 14: 122,137,509 probably benign Het
Tnfaip8l1 T C 17: 56,171,799 F30L probably benign Het
Trav15-2-dv6-2 T A 14: 53,649,976 C118S probably damaging Het
Ttc13 A G 8: 124,682,220 probably benign Het
Ubqln3 A T 7: 104,141,699 S395T probably benign Het
Urb2 A G 8: 124,028,088 D178G probably benign Het
Usf3 A G 16: 44,220,859 I1901V probably benign Het
Vmn1r173 A T 7: 23,702,687 I116F probably benign Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wfikkn2 C T 11: 94,238,862 R151H probably damaging Het
Other mutations in Gstm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Gstm7 APN 3 107930278 missense possibly damaging 0.93
PIT4142001:Gstm7 UTSW 3 107931483 frame shift probably null
R0095:Gstm7 UTSW 3 107930563 splice site probably benign
R0961:Gstm7 UTSW 3 107926986 unclassified probably benign
R1052:Gstm7 UTSW 3 107926950 missense probably benign 0.05
R2121:Gstm7 UTSW 3 107926914 missense probably benign 0.00
R4610:Gstm7 UTSW 3 107926919 missense possibly damaging 0.65
R6393:Gstm7 UTSW 3 107930826 critical splice donor site probably null
R7014:Gstm7 UTSW 3 107926962 missense probably benign 0.00
R7052:Gstm7 UTSW 3 107931317 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGCATGTTACAGCTCCAAC -3'
(R):5'- CCGAATGCAGAGTAGGACTTGG -3'

Sequencing Primer
(F):5'- TGTCAGAGCTGAGTGATGAGG -3'
(R):5'- CTTGGAGGAGGGACAAGGATCC -3'
Posted On2017-03-31