Incidental Mutation 'R5966:L3mbtl3'
ID472107
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene NameL3MBTL3 histone methyl-lysine binding protein
SynonymsMBT-1
MMRRC Submission 044151-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5966 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location26274468-26375971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26331864 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 319 (V319A)
Ref Sequence ENSEMBL: ENSMUSP00000133479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
Predicted Effect unknown
Transcript: ENSMUST00000040219
AA Change: V319A
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: V319A

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105519
AA Change: V294A
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: V294A

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174766
AA Change: V319A
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: V319A

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217699
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,571,687 Y214C probably damaging Het
A930009A15Rik A T 10: 115,579,812 probably benign Het
Acaa2 T C 18: 74,804,152 L369S probably damaging Het
Akna A G 4: 63,394,903 S328P probably damaging Het
Apc A G 18: 34,221,087 probably benign Het
Brca2 C T 5: 150,543,251 T2160I probably damaging Het
Camsap2 A G 1: 136,276,592 S1251P probably damaging Het
Ccdc110 A G 8: 45,942,536 E488G probably damaging Het
Ccdc158 T A 5: 92,650,049 I411F probably damaging Het
Cd163 C T 6: 124,320,636 Q914* probably null Het
Cd22 T C 7: 30,866,658 D827G probably damaging Het
Ces1e A G 8: 93,219,373 probably null Het
Col14a1 T C 15: 55,452,383 probably null Het
Csmd3 T A 15: 47,849,739 D1509V probably damaging Het
Ddx51 A G 5: 110,656,851 D543G probably damaging Het
Diaph3 T A 14: 86,984,825 I408F probably damaging Het
Dld G A 12: 31,340,326 P213L probably damaging Het
Dnah6 T C 6: 73,060,279 T3327A probably benign Het
Dnttip2 T A 3: 122,285,168 probably benign Het
Dock10 T C 1: 80,568,508 E791G possibly damaging Het
Ehd3 G T 17: 73,827,361 W238C probably damaging Het
Ehd3 T G 17: 73,827,366 L240R probably damaging Het
Ep400 A G 5: 110,676,900 V2357A unknown Het
Fam20c T C 5: 138,756,177 V181A probably damaging Het
Gm4781 T C 10: 100,396,952 noncoding transcript Het
Gpatch8 A T 11: 102,480,232 S827T unknown Het
Grm3 A T 5: 9,511,930 I640N probably damaging Het
Gstm7 A G 3: 107,931,431 probably benign Het
Hdac7 G T 15: 97,802,491 H572Q probably damaging Het
Ift140 C T 17: 25,094,761 Q1389* probably null Het
Igfn1 A G 1: 135,965,414 V2099A probably damaging Het
Ik A G 18: 36,755,478 N443S possibly damaging Het
Impact A G 18: 12,990,544 K315E probably benign Het
Insr C A 8: 3,258,697 R113L probably benign Het
Jak2 T A 19: 29,283,554 Y317N possibly damaging Het
Kif18a T A 2: 109,292,066 V162E probably damaging Het
Lepr T C 4: 101,792,127 probably benign Het
Lmo7 C T 14: 101,900,502 T647I possibly damaging Het
Mindy3 C T 2: 12,401,043 R147Q probably benign Het
Mtr T C 13: 12,215,567 probably null Het
Muc4 A T 16: 32,756,278 probably benign Het
Nrip1 G A 16: 76,293,583 T362M possibly damaging Het
Olfr1175-ps A G 2: 88,322,878 S276P probably benign Het
Olfr346 G T 2: 36,688,062 R20L probably null Het
Olfr357 T C 2: 36,996,945 I45T possibly damaging Het
Ovol1 G A 19: 5,551,602 R131C probably damaging Het
Pcca T C 14: 122,668,586 V323A probably damaging Het
Pcdhb14 A T 18: 37,448,242 M134L probably benign Het
Pecam1 G A 11: 106,691,061 T252M probably benign Het
Rnd3 T A 2: 51,132,524 I169F probably damaging Het
Rnmt T A 18: 68,311,618 D219E probably benign Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Ryr2 G T 13: 11,662,238 C3242* probably null Het
Smurf2 G T 11: 106,875,901 R31S possibly damaging Het
Sptbn1 A G 11: 30,124,873 I1333T probably damaging Het
Stard9 G A 2: 120,697,099 C1279Y probably damaging Het
Sugp2 T C 8: 70,252,103 probably null Het
Sulf1 A T 1: 12,859,412 D301V probably benign Het
Tbcd G T 11: 121,601,911 probably benign Het
Tlr11 T C 14: 50,362,255 I566T probably benign Het
Tm9sf2 T A 14: 122,137,509 probably benign Het
Tnfaip8l1 T C 17: 56,171,799 F30L probably benign Het
Trav15-2-dv6-2 T A 14: 53,649,976 C118S probably damaging Het
Ttc13 A G 8: 124,682,220 probably benign Het
Ubqln3 A T 7: 104,141,699 S395T probably benign Het
Urb2 A G 8: 124,028,088 D178G probably benign Het
Usf3 A G 16: 44,220,859 I1901V probably benign Het
Vmn1r173 A T 7: 23,702,687 I116F probably benign Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wfikkn2 C T 11: 94,238,862 R151H probably damaging Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26313846 critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26330185 missense unknown
IGL01712:L3mbtl3 APN 10 26276235 missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26331900 missense unknown
IGL01928:L3mbtl3 APN 10 26330245 missense unknown
IGL01955:L3mbtl3 APN 10 26318438 missense unknown
IGL02674:L3mbtl3 APN 10 26282813 missense unknown
IGL02731:L3mbtl3 APN 10 26344176 critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26342617 missense unknown
IGL03252:L3mbtl3 APN 10 26331812 splice site probably benign
IGL03298:L3mbtl3 APN 10 26282798 missense unknown
IGL03400:L3mbtl3 APN 10 26315526 missense unknown
R0121:L3mbtl3 UTSW 10 26313870 missense unknown
R0468:L3mbtl3 UTSW 10 26327732 missense unknown
R0497:L3mbtl3 UTSW 10 26282874 splice site probably benign
R0586:L3mbtl3 UTSW 10 26327834 missense unknown
R0633:L3mbtl3 UTSW 10 26302685 missense unknown
R0679:L3mbtl3 UTSW 10 26313933 nonsense probably null
R1302:L3mbtl3 UTSW 10 26327769 missense unknown
R2128:L3mbtl3 UTSW 10 26313868 missense unknown
R2267:L3mbtl3 UTSW 10 26331857 nonsense probably null
R3121:L3mbtl3 UTSW 10 26344221 intron probably benign
R3410:L3mbtl3 UTSW 10 26339299 missense unknown
R4237:L3mbtl3 UTSW 10 26340948 missense unknown
R4257:L3mbtl3 UTSW 10 26280122 missense unknown
R4308:L3mbtl3 UTSW 10 26282792 missense unknown
R4359:L3mbtl3 UTSW 10 26327741 missense unknown
R4407:L3mbtl3 UTSW 10 26313884 missense unknown
R4613:L3mbtl3 UTSW 10 26282795 missense unknown
R4663:L3mbtl3 UTSW 10 26337817 missense unknown
R4843:L3mbtl3 UTSW 10 26331879 missense unknown
R4886:L3mbtl3 UTSW 10 26292770 missense unknown
R5158:L3mbtl3 UTSW 10 26303688 missense unknown
R5247:L3mbtl3 UTSW 10 26327808 missense unknown
R5580:L3mbtl3 UTSW 10 26303706 missense unknown
R6218:L3mbtl3 UTSW 10 26292747 missense unknown
R6508:L3mbtl3 UTSW 10 26318427 missense unknown
R6563:L3mbtl3 UTSW 10 26302863 intron probably null
R6709:L3mbtl3 UTSW 10 26282797 missense unknown
R6927:L3mbtl3 UTSW 10 26292669 nonsense probably null
R6984:L3mbtl3 UTSW 10 26282855 missense unknown
R7010:L3mbtl3 UTSW 10 26282861 critical splice acceptor site probably null
R7229:L3mbtl3 UTSW 10 26292662 missense unknown
R7231:L3mbtl3 UTSW 10 26339282 missense unknown
R7296:L3mbtl3 UTSW 10 26282830 missense unknown
R7363:L3mbtl3 UTSW 10 26340952 missense unknown
Predicted Primers PCR Primer
(F):5'- GCATGCTTTACATCATGAACAATTAGC -3'
(R):5'- CCTCTCTGAGTACATGTCACATG -3'

Sequencing Primer
(F):5'- TCGGAGTTGGCATCTAAG -3'
(R):5'- CATGTCACATGTGATACCTATGC -3'
Posted On2017-03-31