Incidental Mutation 'R5966:Ovol1'
ID472140
Institutional Source Beutler Lab
Gene Symbol Ovol1
Ensembl Gene ENSMUSG00000024922
Gene Nameovo like zinc finger 1
SynonymsOvo1, movo1
MMRRC Submission 044151-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R5966 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5549137-5560575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5551602 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 131 (R131C)
Ref Sequence ENSEMBL: ENSMUSP00000025861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025861]
Predicted Effect probably damaging
Transcript: ENSMUST00000025861
AA Change: R131C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025861
Gene: ENSMUSG00000024922
AA Change: R131C

DomainStartEndE-ValueType
ZnF_C2H2 118 140 1.1e-2 SMART
ZnF_C2H2 146 168 1.82e-3 SMART
ZnF_C2H2 174 197 2.99e-4 SMART
ZnF_C2H2 213 236 8.09e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211026
Meta Mutation Damage Score 0.46 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative zinc finger containing transcription factor that is highly similar to homologous protein in Drosophila and mouse. Based on known functions in these species, this protein is likely involved in hair formation and spermatogenesis in human as well. [provided by RefSeq, Aug 2011]
PHENOTYPE: Null mutant homozygotes show reduced growth, abnormal hair, and cystic kidneys. Females are subfertile with dilated uterus and cervix, and constricted or imperforate vagina. Mutant males have small testes, with few mature germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,571,687 Y214C probably damaging Het
A930009A15Rik A T 10: 115,579,812 probably benign Het
Acaa2 T C 18: 74,804,152 L369S probably damaging Het
Akna A G 4: 63,394,903 S328P probably damaging Het
Apc A G 18: 34,221,087 probably benign Het
Brca2 C T 5: 150,543,251 T2160I probably damaging Het
Camsap2 A G 1: 136,276,592 S1251P probably damaging Het
Ccdc110 A G 8: 45,942,536 E488G probably damaging Het
Ccdc158 T A 5: 92,650,049 I411F probably damaging Het
Cd163 C T 6: 124,320,636 Q914* probably null Het
Cd22 T C 7: 30,866,658 D827G probably damaging Het
Ces1e A G 8: 93,219,373 probably null Het
Col14a1 T C 15: 55,452,383 probably null Het
Csmd3 T A 15: 47,849,739 D1509V probably damaging Het
Ddx51 A G 5: 110,656,851 D543G probably damaging Het
Diaph3 T A 14: 86,984,825 I408F probably damaging Het
Dld G A 12: 31,340,326 P213L probably damaging Het
Dnah6 T C 6: 73,060,279 T3327A probably benign Het
Dnttip2 T A 3: 122,285,168 probably benign Het
Dock10 T C 1: 80,568,508 E791G possibly damaging Het
Ehd3 G T 17: 73,827,361 W238C probably damaging Het
Ehd3 T G 17: 73,827,366 L240R probably damaging Het
Ep400 A G 5: 110,676,900 V2357A unknown Het
Fam20c T C 5: 138,756,177 V181A probably damaging Het
Gm4781 T C 10: 100,396,952 noncoding transcript Het
Gpatch8 A T 11: 102,480,232 S827T unknown Het
Grm3 A T 5: 9,511,930 I640N probably damaging Het
Gstm7 A G 3: 107,931,431 probably benign Het
Hdac7 G T 15: 97,802,491 H572Q probably damaging Het
Ift140 C T 17: 25,094,761 Q1389* probably null Het
Igfn1 A G 1: 135,965,414 V2099A probably damaging Het
Ik A G 18: 36,755,478 N443S possibly damaging Het
Impact A G 18: 12,990,544 K315E probably benign Het
Insr C A 8: 3,258,697 R113L probably benign Het
Jak2 T A 19: 29,283,554 Y317N possibly damaging Het
Kif18a T A 2: 109,292,066 V162E probably damaging Het
L3mbtl3 A G 10: 26,331,864 V319A unknown Het
Lepr T C 4: 101,792,127 probably benign Het
Lmo7 C T 14: 101,900,502 T647I possibly damaging Het
Mindy3 C T 2: 12,401,043 R147Q probably benign Het
Mtr T C 13: 12,215,567 probably null Het
Muc4 A T 16: 32,756,278 probably benign Het
Nrip1 G A 16: 76,293,583 T362M possibly damaging Het
Olfr1175-ps A G 2: 88,322,878 S276P probably benign Het
Olfr346 G T 2: 36,688,062 R20L probably null Het
Olfr357 T C 2: 36,996,945 I45T possibly damaging Het
Pcca T C 14: 122,668,586 V323A probably damaging Het
Pcdhb14 A T 18: 37,448,242 M134L probably benign Het
Pecam1 G A 11: 106,691,061 T252M probably benign Het
Rnd3 T A 2: 51,132,524 I169F probably damaging Het
Rnmt T A 18: 68,311,618 D219E probably benign Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Ryr2 G T 13: 11,662,238 C3242* probably null Het
Smurf2 G T 11: 106,875,901 R31S possibly damaging Het
Sptbn1 A G 11: 30,124,873 I1333T probably damaging Het
Stard9 G A 2: 120,697,099 C1279Y probably damaging Het
Sugp2 T C 8: 70,252,103 probably null Het
Sulf1 A T 1: 12,859,412 D301V probably benign Het
Tbcd G T 11: 121,601,911 probably benign Het
Tlr11 T C 14: 50,362,255 I566T probably benign Het
Tm9sf2 T A 14: 122,137,509 probably benign Het
Tnfaip8l1 T C 17: 56,171,799 F30L probably benign Het
Trav15-2-dv6-2 T A 14: 53,649,976 C118S probably damaging Het
Ttc13 A G 8: 124,682,220 probably benign Het
Ubqln3 A T 7: 104,141,699 S395T probably benign Het
Urb2 A G 8: 124,028,088 D178G probably benign Het
Usf3 A G 16: 44,220,859 I1901V probably benign Het
Vmn1r173 A T 7: 23,702,687 I116F probably benign Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wfikkn2 C T 11: 94,238,862 R151H probably damaging Het
Other mutations in Ovol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02307:Ovol1 APN 19 5553615 missense possibly damaging 0.55
IGL02874:Ovol1 APN 19 5551181 missense probably damaging 1.00
IGL02974:Ovol1 APN 19 5551149 missense probably damaging 1.00
IGL03157:Ovol1 APN 19 5551607 missense probably benign
R1252:Ovol1 UTSW 19 5553601 missense probably benign
R1611:Ovol1 UTSW 19 5551070 missense probably damaging 1.00
R1662:Ovol1 UTSW 19 5551639 missense probably damaging 0.98
R4728:Ovol1 UTSW 19 5553662 nonsense probably null
R7020:Ovol1 UTSW 19 5560233 missense probably damaging 1.00
R7449:Ovol1 UTSW 19 5553597 missense probably benign 0.01
R7567:Ovol1 UTSW 19 5551586 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTATGAGTTCAGGGCTCTTCC -3'
(R):5'- TCTTGGCAGATGTCACAGGC -3'

Sequencing Primer
(F):5'- GGCTCTTCCCTCAGATCCAGG -3'
(R):5'- AGATGTCACAGGCCACGATCG -3'
Posted On2017-03-31