Incidental Mutation 'R5946:Arpc3'
ID472163
Institutional Source Beutler Lab
Gene Symbol Arpc3
Ensembl Gene ENSMUSG00000029465
Gene Nameactin related protein 2/3 complex, subunit 3
SynonymsArp2/3 complex subunit p21-Arc, p21-Ar, 1110006A04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5946 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122391878-122414184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122403396 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 57 (Y57C)
Ref Sequence ENSEMBL: ENSMUSP00000107345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031421] [ENSMUST00000102525] [ENSMUST00000111713] [ENSMUST00000111716]
Predicted Effect probably damaging
Transcript: ENSMUST00000031421
AA Change: Y66C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031421
Gene: ENSMUSG00000029465
AA Change: Y66C

DomainStartEndE-ValueType
Pfam:P21-Arc 1 165 5.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102525
AA Change: Y74C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099584
Gene: ENSMUSG00000029465
AA Change: Y74C

DomainStartEndE-ValueType
Pfam:P21-Arc 1 173 1.6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111713
AA Change: Y59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107342
Gene: ENSMUSG00000029465
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:P21-Arc 5 158 2.5e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111716
AA Change: Y57C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107345
Gene: ENSMUSG00000029465
AA Change: Y57C

DomainStartEndE-ValueType
Pfam:P21-Arc 4 156 2.7e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148913
Predicted Effect unknown
Transcript: ENSMUST00000196969
AA Change: Y55C
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been conserved through evolution and is implicated in the control of actin polymerization in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a transposon-induced allele develop only to the blastocyst stage and show defects in trophoblast outgrowth and in the dynamics of actin accumulation. Mice heterozygous for the same transposon-induced allele and a knock-out allele showimpaired trophoblast outgrowth activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,625,952 F1137S probably damaging Het
Actr6 G T 10: 89,728,192 Q73K probably benign Het
Adamtsl3 G A 7: 82,576,057 G358D probably damaging Het
Aggf1 A G 13: 95,371,576 V94A probably damaging Het
Asb2 A G 12: 103,321,555 Y630H probably benign Het
Atp1a1 A T 3: 101,589,774 N405K probably benign Het
C6 G T 15: 4,808,514 D869Y possibly damaging Het
Cds2 A G 2: 132,297,248 Y137C probably damaging Het
Ceacam12 A T 7: 18,069,206 E179V probably damaging Het
Chgb T A 2: 132,792,596 Y153N probably benign Het
Cit T A 5: 115,997,534 L1831Q probably damaging Het
Cpne8 C A 15: 90,488,988 *578L probably null Het
Cspg5 A G 9: 110,251,083 T440A probably damaging Het
Dnah7a A C 1: 53,559,308 V1393G probably damaging Het
Dnajb8 A G 6: 88,222,593 D37G probably benign Het
Dst A G 1: 34,174,192 I1063M probably benign Het
Efs T G 14: 54,919,494 probably null Het
Gpatch1 A G 7: 35,291,832 S596P probably damaging Het
Hbs1l C A 10: 21,341,756 H190Q probably benign Het
Ighm A G 12: 113,422,709 V7A unknown Het
Ivd A T 2: 118,876,889 I295F possibly damaging Het
Kcnq5 A C 1: 21,505,707 S258A probably damaging Het
Mad1l1 G T 5: 140,261,579 P331Q probably damaging Het
Mcf2l G T 8: 13,013,922 G1045C probably damaging Het
Mcoln1 T A 8: 3,508,701 I233N probably damaging Het
Mmp13 T C 9: 7,276,580 L225P probably damaging Het
Muc5ac G A 7: 141,817,907 C2615Y possibly damaging Het
Myh7b T C 2: 155,621,395 F516L probably damaging Het
Obsl1 A T 1: 75,491,207 S1347R probably damaging Het
Ogn A G 13: 49,618,285 N207S probably benign Het
Olfr132 C A 17: 38,130,707 A162S probably benign Het
Olfr874 T A 9: 37,747,034 L300Q probably damaging Het
Pcdha2 G T 18: 36,941,106 V597L probably damaging Het
Pcnt T A 10: 76,382,063 Y2126F possibly damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Pklr A T 3: 89,136,196 E5V probably benign Het
Pkp4 T A 2: 59,305,067 D94E probably benign Het
Ppan C T 9: 20,889,673 Q111* probably null Het
Prkcb A G 7: 122,544,703 N330S probably benign Het
Prl4a1 T A 13: 28,018,516 W25R probably damaging Het
Rars2 T A 4: 34,656,855 H501Q possibly damaging Het
Ryr2 T C 13: 11,726,953 D2114G probably damaging Het
Serinc2 G T 4: 130,255,521 T351K possibly damaging Het
Slc22a12 A G 19: 6,537,851 F358L probably damaging Het
Sorcs2 A C 5: 36,029,083 V905G probably damaging Het
Tekt3 G C 11: 63,094,747 A460P probably damaging Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Tmc5 A T 7: 118,670,725 E899D probably damaging Het
Tmem268 C T 4: 63,568,509 P90S probably damaging Het
Trim38 A G 13: 23,782,734 M55V probably benign Het
Trip10 T G 17: 57,250,963 V50G probably damaging Het
Usp25 T A 16: 77,115,054 C990* probably null Het
Uts2 A G 4: 150,999,049 D39G probably benign Het
Vezf1 T A 11: 88,073,734 C49* probably null Het
Wee2 T A 6: 40,463,212 N431K probably null Het
Yeats2 C A 16: 20,207,763 Y796* probably null Het
Zfp592 G A 7: 81,037,897 G890D possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Arpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01998:Arpc3 APN 5 122403407 missense probably damaging 1.00
IGL03201:Arpc3 APN 5 122401718 missense probably damaging 1.00
R1240:Arpc3 UTSW 5 122404179 missense probably damaging 1.00
R4704:Arpc3 UTSW 5 122400408 start codon destroyed probably null 0.00
R4797:Arpc3 UTSW 5 122404152 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCCTACACAGCATGAGGAAG -3'
(R):5'- GACTCTAACACGGCTGTCTG -3'

Sequencing Primer
(F):5'- CATGAGGAAGGGGCTGTTG -3'
(R):5'- GGCTGTCTGCTGCTGTCC -3'
Posted On2017-03-31