Incidental Mutation 'R5946:Usp25'
ID472202
Institutional Source Beutler Lab
Gene Symbol Usp25
Ensembl Gene ENSMUSG00000022867
Gene Nameubiquitin specific peptidase 25
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5946 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location77013706-77116780 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 77115054 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 990 (C990*)
Ref Sequence ENSEMBL: ENSMUSP00000023580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023580]
PDB Structure
Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000023580
AA Change: C990*
SMART Domains Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: C990*

DomainStartEndE-ValueType
PDB:1VDL|A 1 67 2e-35 PDB
Blast:UBA 17 56 9e-16 BLAST
UIM 97 116 5.27e-3 SMART
Pfam:UIM 124 140 6.7e-3 PFAM
Pfam:UCH 168 655 9.3e-55 PFAM
Pfam:UCH_1 169 632 3.1e-14 PFAM
coiled coil region 685 714 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,625,952 F1137S probably damaging Het
Actr6 G T 10: 89,728,192 Q73K probably benign Het
Adamtsl3 G A 7: 82,576,057 G358D probably damaging Het
Aggf1 A G 13: 95,371,576 V94A probably damaging Het
Arpc3 A G 5: 122,403,396 Y57C probably damaging Het
Asb2 A G 12: 103,321,555 Y630H probably benign Het
Atp1a1 A T 3: 101,589,774 N405K probably benign Het
C6 G T 15: 4,808,514 D869Y possibly damaging Het
Cds2 A G 2: 132,297,248 Y137C probably damaging Het
Ceacam12 A T 7: 18,069,206 E179V probably damaging Het
Chgb T A 2: 132,792,596 Y153N probably benign Het
Cit T A 5: 115,997,534 L1831Q probably damaging Het
Cpne8 C A 15: 90,488,988 *578L probably null Het
Cspg5 A G 9: 110,251,083 T440A probably damaging Het
Dnah7a A C 1: 53,559,308 V1393G probably damaging Het
Dnajb8 A G 6: 88,222,593 D37G probably benign Het
Dst A G 1: 34,174,192 I1063M probably benign Het
Efs T G 14: 54,919,494 probably null Het
Gpatch1 A G 7: 35,291,832 S596P probably damaging Het
Hbs1l C A 10: 21,341,756 H190Q probably benign Het
Ighm A G 12: 113,422,709 V7A unknown Het
Ivd A T 2: 118,876,889 I295F possibly damaging Het
Kcnq5 A C 1: 21,505,707 S258A probably damaging Het
Mad1l1 G T 5: 140,261,579 P331Q probably damaging Het
Mcf2l G T 8: 13,013,922 G1045C probably damaging Het
Mcoln1 T A 8: 3,508,701 I233N probably damaging Het
Mmp13 T C 9: 7,276,580 L225P probably damaging Het
Muc5ac G A 7: 141,817,907 C2615Y possibly damaging Het
Myh7b T C 2: 155,621,395 F516L probably damaging Het
Obsl1 A T 1: 75,491,207 S1347R probably damaging Het
Ogn A G 13: 49,618,285 N207S probably benign Het
Olfr132 C A 17: 38,130,707 A162S probably benign Het
Olfr874 T A 9: 37,747,034 L300Q probably damaging Het
Pcdha2 G T 18: 36,941,106 V597L probably damaging Het
Pcnt T A 10: 76,382,063 Y2126F possibly damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Pklr A T 3: 89,136,196 E5V probably benign Het
Pkp4 T A 2: 59,305,067 D94E probably benign Het
Ppan C T 9: 20,889,673 Q111* probably null Het
Prkcb A G 7: 122,544,703 N330S probably benign Het
Prl4a1 T A 13: 28,018,516 W25R probably damaging Het
Rars2 T A 4: 34,656,855 H501Q possibly damaging Het
Ryr2 T C 13: 11,726,953 D2114G probably damaging Het
Serinc2 G T 4: 130,255,521 T351K possibly damaging Het
Slc22a12 A G 19: 6,537,851 F358L probably damaging Het
Sorcs2 A C 5: 36,029,083 V905G probably damaging Het
Tekt3 G C 11: 63,094,747 A460P probably damaging Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Tmc5 A T 7: 118,670,725 E899D probably damaging Het
Tmem268 C T 4: 63,568,509 P90S probably damaging Het
Trim38 A G 13: 23,782,734 M55V probably benign Het
Trip10 T G 17: 57,250,963 V50G probably damaging Het
Uts2 A G 4: 150,999,049 D39G probably benign Het
Vezf1 T A 11: 88,073,734 C49* probably null Het
Wee2 T A 6: 40,463,212 N431K probably null Het
Yeats2 C A 16: 20,207,763 Y796* probably null Het
Zfp592 G A 7: 81,037,897 G890D possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Usp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Usp25 APN 16 77062405 missense probably damaging 1.00
IGL01359:Usp25 APN 16 77059253 missense probably damaging 1.00
IGL01380:Usp25 APN 16 77093678 missense probably benign 0.06
IGL01614:Usp25 APN 16 77077117 missense probably damaging 1.00
IGL02065:Usp25 APN 16 77083782 missense probably benign 0.06
IGL02271:Usp25 APN 16 77115447 missense probably damaging 1.00
IGL03184:Usp25 APN 16 77081653 missense probably damaging 1.00
IGL03046:Usp25 UTSW 16 77074866 missense probably damaging 1.00
R0433:Usp25 UTSW 16 77109217 missense probably benign 0.02
R0741:Usp25 UTSW 16 77071708 missense possibly damaging 0.80
R0944:Usp25 UTSW 16 77081447 splice site probably benign
R1324:Usp25 UTSW 16 77080387 missense probably damaging 0.98
R1341:Usp25 UTSW 16 77115443 missense probably benign
R1373:Usp25 UTSW 16 77062385 splice site probably benign
R1641:Usp25 UTSW 16 77071671 missense possibly damaging 0.89
R1777:Usp25 UTSW 16 77081554 missense probably damaging 1.00
R1813:Usp25 UTSW 16 77114950 missense probably benign 0.00
R1960:Usp25 UTSW 16 77076371 missense probably damaging 1.00
R2256:Usp25 UTSW 16 77113794 missense probably benign
R2271:Usp25 UTSW 16 77076429 missense probably damaging 0.97
R4404:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4408:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4502:Usp25 UTSW 16 77115396 missense probably damaging 1.00
R4604:Usp25 UTSW 16 77115415 missense probably damaging 1.00
R4612:Usp25 UTSW 16 77033945 missense possibly damaging 0.92
R4744:Usp25 UTSW 16 77114989 missense probably damaging 1.00
R4867:Usp25 UTSW 16 77050467 missense probably damaging 1.00
R4932:Usp25 UTSW 16 77033982 critical splice donor site probably null
R5087:Usp25 UTSW 16 77077119 missense probably benign 0.00
R5165:Usp25 UTSW 16 77076405 missense possibly damaging 0.85
R5184:Usp25 UTSW 16 77109227 missense probably benign 0.00
R5307:Usp25 UTSW 16 77093706 missense probably benign
R5331:Usp25 UTSW 16 77050558 missense probably damaging 1.00
R5355:Usp25 UTSW 16 77050454 missense probably damaging 1.00
R5479:Usp25 UTSW 16 77107913 missense possibly damaging 0.51
R5619:Usp25 UTSW 16 77033945 missense probably benign 0.22
R5646:Usp25 UTSW 16 77050472 missense probably benign 0.34
R6013:Usp25 UTSW 16 77077021 missense probably benign 0.00
R6418:Usp25 UTSW 16 77062442 missense probably damaging 1.00
R6653:Usp25 UTSW 16 77059288 missense probably benign 0.29
R6709:Usp25 UTSW 16 77083932 missense probably benign
R6987:Usp25 UTSW 16 77077180 missense probably damaging 1.00
X0065:Usp25 UTSW 16 77081556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCATCATGTTCAGGTTCTCC -3'
(R):5'- TGCTAGCTTGTAACGGAGGG -3'

Sequencing Primer
(F):5'- CGATGAAGCAAAATGTGTTCTCTTC -3'
(R):5'- CTTGTAACGGAGGGAGGGGC -3'
Posted On2017-03-31