Incidental Mutation 'R5947:Gna12'
ID472225
Institutional Source Beutler Lab
Gene Symbol Gna12
Ensembl Gene ENSMUSG00000000149
Gene Nameguanine nucleotide binding protein, alpha 12
SynonymsGalpha12
MMRRC Submission 044138-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R5947 (G1)
Quality Score223
Status Validated
Chromosome5
Chromosomal Location140758408-140830431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140760962 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 243 (I243F)
Ref Sequence ENSEMBL: ENSMUSP00000000153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000153]
PDB Structure
Crystal structure of G alpha 12 in complex with GDP, Mg2+ and AlF4- [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000000153
AA Change: I243F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000153
Gene: ENSMUSG00000000149
AA Change: I243F

DomainStartEndE-ValueType
G_alpha 35 378 1.07e-193 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176035
Predicted Effect unknown
Transcript: ENSMUST00000198447
AA Change: I179F
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Mice deficient for this gene do not exhibit any detectable abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 123,967,998 probably null Het
Abt1 T C 13: 23,422,055 E243G possibly damaging Het
Afap1l1 A G 18: 61,743,700 S361P probably damaging Het
Alms1 T C 6: 85,619,712 S507P probably benign Het
Atp13a3 A G 16: 30,362,700 V34A probably benign Het
Atpaf2 A T 11: 60,405,882 probably benign Het
Bbs1 A C 19: 4,892,994 L456R probably benign Het
Bri3bp G T 5: 125,452,153 G84* probably null Het
Bri3bp G C 5: 125,452,154 probably benign Het
Car10 A C 11: 93,490,613 H134P probably damaging Het
Cntrl A G 2: 35,116,679 E119G probably damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Dirc2 T C 16: 35,730,306 T308A probably benign Het
Dppa4 T C 16: 48,291,108 V100A possibly damaging Het
Elmo1 G T 13: 20,290,383 E105* probably null Het
Esrp2 T G 8: 106,132,933 probably benign Het
Exoc3l4 A G 12: 111,422,401 K108R possibly damaging Het
Exph5 G A 9: 53,375,222 R1201H probably benign Het
Galnt3 A C 2: 66,084,156 probably benign Het
Gm14486 C T 2: 30,658,801 noncoding transcript Het
Itga5 A T 15: 103,356,785 W232R probably damaging Het
Lekr1 A T 3: 65,773,077 noncoding transcript Het
Lrp1 C T 10: 127,589,554 probably null Het
Mast4 T C 13: 102,735,640 M2215V probably benign Het
Mfap5 T C 6: 122,525,986 Y52H probably damaging Het
Mrps31 A G 8: 22,414,975 K127E possibly damaging Het
Mto1 C T 9: 78,461,029 T485M probably damaging Het
Mybbp1a G A 11: 72,442,431 C107Y probably damaging Het
Nedd4 G A 9: 72,730,850 probably benign Het
Nek2 A G 1: 191,829,485 E360G probably benign Het
Notch1 T A 2: 26,462,528 probably benign Het
Nubp1 T C 16: 10,420,186 probably benign Het
Pcdhb1 G A 18: 37,266,673 R559H possibly damaging Het
Pdcd11 G A 19: 47,129,263 V1684I probably benign Het
Pggt1b G T 18: 46,248,940 N258K probably benign Het
Pou6f1 C T 15: 100,586,120 V166M possibly damaging Het
Pprc1 A G 19: 46,063,672 D546G possibly damaging Het
Psapl1 T C 5: 36,204,307 V81A probably benign Het
Rin2 T A 2: 145,844,943 probably benign Het
Rpf1 A G 3: 146,506,544 F347S probably damaging Het
Rrp12 A T 19: 41,870,808 probably null Het
Ryr1 A T 7: 29,071,924 L2557Q probably null Het
Slc1a7 T C 4: 108,010,300 probably benign Het
Slc35e2 T A 4: 155,611,714 M186K possibly damaging Het
Snx6 G T 12: 54,770,764 S116* probably null Het
Sptan1 T C 2: 29,994,367 probably null Het
Sucla2 T A 14: 73,592,669 M382K probably damaging Het
Susd5 T C 9: 114,057,591 L16P possibly damaging Het
Tmem260 G A 14: 48,486,801 A369T possibly damaging Het
Tmprss6 A G 15: 78,452,522 Y393H probably damaging Het
Tnrc6c A T 11: 117,722,519 Q501L probably damaging Het
Trim17 A G 11: 58,965,543 Y142C probably damaging Het
Trim65 T C 11: 116,128,282 R144G probably damaging Het
Trpm1 A G 7: 64,223,799 T601A probably benign Het
Ttn A T 2: 76,734,344 V28483E probably damaging Het
Ube2l3 G T 16: 17,201,472 probably benign Het
Ube2l3 T C 16: 17,201,476 probably null Het
Yme1l1 T C 2: 23,195,306 probably benign Het
Zfat A G 15: 68,179,957 S663P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Gna12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Gna12 APN 5 140761018 missense probably damaging 1.00
PIT4434001:Gna12 UTSW 5 140761018 missense probably damaging 1.00
R0568:Gna12 UTSW 5 140760883 missense possibly damaging 0.75
R1793:Gna12 UTSW 5 140760952 missense probably damaging 1.00
R1839:Gna12 UTSW 5 140762612 missense probably benign 0.01
R2847:Gna12 UTSW 5 140785593 missense probably damaging 1.00
R5053:Gna12 UTSW 5 140760727 missense probably benign 0.05
R6233:Gna12 UTSW 5 140760692 missense possibly damaging 0.68
R7062:Gna12 UTSW 5 140785485 missense probably benign 0.00
R7238:Gna12 UTSW 5 140830092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAGGTCCATCTTGTTG -3'
(R):5'- AATGTTCTTGCACGGGTCCC -3'

Sequencing Primer
(F):5'- CAGGAGGTCCATCTTGTTGAGGAAG -3'
(R):5'- GCAGTCTGTCTCTCTGCCAG -3'
Posted On2017-03-31