Incidental Mutation 'R5947:Exph5'
ID472233
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Nameexophilin 5
SynonymsSlac2b, AC079869.22gm5, B130009M24Rik, slac2-b
MMRRC Submission 044138-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5947 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53301670-53377514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53375222 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1201 (R1201H)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
Predicted Effect probably benign
Transcript: ENSMUST00000051014
AA Change: R1201H

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: R1201H

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 123,967,998 probably null Het
Abt1 T C 13: 23,422,055 E243G possibly damaging Het
Afap1l1 A G 18: 61,743,700 S361P probably damaging Het
Alms1 T C 6: 85,619,712 S507P probably benign Het
Atp13a3 A G 16: 30,362,700 V34A probably benign Het
Atpaf2 A T 11: 60,405,882 probably benign Het
Bbs1 A C 19: 4,892,994 L456R probably benign Het
Bri3bp G T 5: 125,452,153 G84* probably null Het
Bri3bp G C 5: 125,452,154 probably benign Het
Car10 A C 11: 93,490,613 H134P probably damaging Het
Cntrl A G 2: 35,116,679 E119G probably damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Dirc2 T C 16: 35,730,306 T308A probably benign Het
Dppa4 T C 16: 48,291,108 V100A possibly damaging Het
Elmo1 G T 13: 20,290,383 E105* probably null Het
Esrp2 T G 8: 106,132,933 probably benign Het
Exoc3l4 A G 12: 111,422,401 K108R possibly damaging Het
Galnt3 A C 2: 66,084,156 probably benign Het
Gm14486 C T 2: 30,658,801 noncoding transcript Het
Gna12 T A 5: 140,760,962 I243F probably damaging Het
Itga5 A T 15: 103,356,785 W232R probably damaging Het
Lekr1 A T 3: 65,773,077 noncoding transcript Het
Lrp1 C T 10: 127,589,554 probably null Het
Mast4 T C 13: 102,735,640 M2215V probably benign Het
Mfap5 T C 6: 122,525,986 Y52H probably damaging Het
Mrps31 A G 8: 22,414,975 K127E possibly damaging Het
Mto1 C T 9: 78,461,029 T485M probably damaging Het
Mybbp1a G A 11: 72,442,431 C107Y probably damaging Het
Nedd4 G A 9: 72,730,850 probably benign Het
Nek2 A G 1: 191,829,485 E360G probably benign Het
Notch1 T A 2: 26,462,528 probably benign Het
Nubp1 T C 16: 10,420,186 probably benign Het
Pcdhb1 G A 18: 37,266,673 R559H possibly damaging Het
Pdcd11 G A 19: 47,129,263 V1684I probably benign Het
Pggt1b G T 18: 46,248,940 N258K probably benign Het
Pou6f1 C T 15: 100,586,120 V166M possibly damaging Het
Pprc1 A G 19: 46,063,672 D546G possibly damaging Het
Psapl1 T C 5: 36,204,307 V81A probably benign Het
Rin2 T A 2: 145,844,943 probably benign Het
Rpf1 A G 3: 146,506,544 F347S probably damaging Het
Rrp12 A T 19: 41,870,808 probably null Het
Ryr1 A T 7: 29,071,924 L2557Q probably null Het
Slc1a7 T C 4: 108,010,300 probably benign Het
Slc35e2 T A 4: 155,611,714 M186K possibly damaging Het
Snx6 G T 12: 54,770,764 S116* probably null Het
Sptan1 T C 2: 29,994,367 probably null Het
Sucla2 T A 14: 73,592,669 M382K probably damaging Het
Susd5 T C 9: 114,057,591 L16P possibly damaging Het
Tmem260 G A 14: 48,486,801 A369T possibly damaging Het
Tmprss6 A G 15: 78,452,522 Y393H probably damaging Het
Tnrc6c A T 11: 117,722,519 Q501L probably damaging Het
Trim17 A G 11: 58,965,543 Y142C probably damaging Het
Trim65 T C 11: 116,128,282 R144G probably damaging Het
Trpm1 A G 7: 64,223,799 T601A probably benign Het
Ttn A T 2: 76,734,344 V28483E probably damaging Het
Ube2l3 G T 16: 17,201,472 probably benign Het
Ube2l3 T C 16: 17,201,476 probably null Het
Yme1l1 T C 2: 23,195,306 probably benign Het
Zfat A G 15: 68,179,957 S663P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53376706 nonsense probably null
IGL01387:Exph5 APN 9 53373965 missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53376569 missense probably damaging 0.99
IGL02122:Exph5 APN 9 53373674 missense probably benign 0.05
IGL02156:Exph5 APN 9 53375641 missense probably damaging 0.96
IGL02192:Exph5 APN 9 53376325 nonsense probably null
IGL02491:Exph5 APN 9 53375043 missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53374978 missense probably damaging 0.96
R0002:Exph5 UTSW 9 53373956 missense probably damaging 0.99
R0026:Exph5 UTSW 9 53376479 missense probably benign 0.38
R0086:Exph5 UTSW 9 53337930 missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53353204 critical splice donor site probably null
R0369:Exph5 UTSW 9 53373302 missense probably benign 0.35
R0409:Exph5 UTSW 9 53374343 missense probably benign 0.00
R0517:Exph5 UTSW 9 53372762 missense probably benign 0.02
R0658:Exph5 UTSW 9 53377475 missense unknown
R1606:Exph5 UTSW 9 53374295 missense probably benign 0.37
R1739:Exph5 UTSW 9 53375588 missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53373809 missense probably benign 0.35
R1828:Exph5 UTSW 9 53376641 missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53376248 missense probably benign
R1993:Exph5 UTSW 9 53373635 missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53367166 missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53372679 missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53374925 nonsense probably null
R3817:Exph5 UTSW 9 53375494 nonsense probably null
R4771:Exph5 UTSW 9 53373665 missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53376239 missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53376625 missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53375610 missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53337930 missense probably damaging 0.99
R5522:Exph5 UTSW 9 53374313 missense possibly damaging 0.90
R5961:Exph5 UTSW 9 53377255 missense probably damaging 1.00
R6093:Exph5 UTSW 9 53372617 missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53373028 missense probably benign 0.21
R6254:Exph5 UTSW 9 53372710 missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53376691 missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53301712 start gained probably benign
R6792:Exph5 UTSW 9 53375317 missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53340428 missense probably benign 0.27
R7340:Exph5 UTSW 9 53377009 missense probably damaging 0.99
R7347:Exph5 UTSW 9 53375896 missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53375722 missense probably benign 0.00
X0028:Exph5 UTSW 9 53376263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGTCCTGGGCATGGATG -3'
(R):5'- TCTAAGTGAATCGGTACCTTGTG -3'

Sequencing Primer
(F):5'- ATGGATGCTTCTCCTGTAATACCCAG -3'
(R):5'- AAGTGAATCGGTACCTTGTGTGTAC -3'
Posted On2017-03-31