Incidental Mutation 'R5947:Atp13a3'
ID472255
Institutional Source Beutler Lab
Gene Symbol Atp13a3
Ensembl Gene ENSMUSG00000022533
Gene NameATPase type 13A3
SynonymsLOC224088, LOC385637, LOC224087
MMRRC Submission 044138-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R5947 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location30312423-30405975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30362700 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 34 (V34A)
Ref Sequence ENSEMBL: ENSMUSP00000128224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061350] [ENSMUST00000100013] [ENSMUST00000229616]
Predicted Effect probably benign
Transcript: ENSMUST00000061350
AA Change: V34A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000051645
Gene: ENSMUSG00000022533
AA Change: V34A

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 139 4.9e-30 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 5.1e-36 PFAM
Pfam:HAD 491 888 7.5e-28 PFAM
Pfam:Hydrolase_like2 607 661 6.8e-8 PFAM
Pfam:Hydrolase 612 790 6.5e-11 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100013
AA Change: V34A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128224
Gene: ENSMUSG00000022533
AA Change: V34A

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 146 2.9e-38 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 7.3e-41 PFAM
Pfam:Hydrolase 488 784 1.3e-12 PFAM
Pfam:HAD 491 888 1.3e-31 PFAM
Pfam:Cation_ATPase 612 660 4.5e-7 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1157 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153656
Predicted Effect probably benign
Transcript: ENSMUST00000229616
AA Change: V34A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1456 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP13A3 is a member of the P-type ATPase family of proteins that transport a variety of cations across membranes. Other P-type ATPases include ATP7B (MIM 606882) and ATP7A (MIM 300011).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 123,967,998 probably null Het
Abt1 T C 13: 23,422,055 E243G possibly damaging Het
Afap1l1 A G 18: 61,743,700 S361P probably damaging Het
Alms1 T C 6: 85,619,712 S507P probably benign Het
Atpaf2 A T 11: 60,405,882 probably benign Het
Bbs1 A C 19: 4,892,994 L456R probably benign Het
Bri3bp G T 5: 125,452,153 G84* probably null Het
Bri3bp G C 5: 125,452,154 probably benign Het
Car10 A C 11: 93,490,613 H134P probably damaging Het
Cntrl A G 2: 35,116,679 E119G probably damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Dirc2 T C 16: 35,730,306 T308A probably benign Het
Dppa4 T C 16: 48,291,108 V100A possibly damaging Het
Elmo1 G T 13: 20,290,383 E105* probably null Het
Esrp2 T G 8: 106,132,933 probably benign Het
Exoc3l4 A G 12: 111,422,401 K108R possibly damaging Het
Exph5 G A 9: 53,375,222 R1201H probably benign Het
Galnt3 A C 2: 66,084,156 probably benign Het
Gm14486 C T 2: 30,658,801 noncoding transcript Het
Gna12 T A 5: 140,760,962 I243F probably damaging Het
Itga5 A T 15: 103,356,785 W232R probably damaging Het
Lekr1 A T 3: 65,773,077 noncoding transcript Het
Lrp1 C T 10: 127,589,554 probably null Het
Mast4 T C 13: 102,735,640 M2215V probably benign Het
Mfap5 T C 6: 122,525,986 Y52H probably damaging Het
Mrps31 A G 8: 22,414,975 K127E possibly damaging Het
Mto1 C T 9: 78,461,029 T485M probably damaging Het
Mybbp1a G A 11: 72,442,431 C107Y probably damaging Het
Nedd4 G A 9: 72,730,850 probably benign Het
Nek2 A G 1: 191,829,485 E360G probably benign Het
Notch1 T A 2: 26,462,528 probably benign Het
Nubp1 T C 16: 10,420,186 probably benign Het
Pcdhb1 G A 18: 37,266,673 R559H possibly damaging Het
Pdcd11 G A 19: 47,129,263 V1684I probably benign Het
Pggt1b G T 18: 46,248,940 N258K probably benign Het
Pou6f1 C T 15: 100,586,120 V166M possibly damaging Het
Pprc1 A G 19: 46,063,672 D546G possibly damaging Het
Psapl1 T C 5: 36,204,307 V81A probably benign Het
Rin2 T A 2: 145,844,943 probably benign Het
Rpf1 A G 3: 146,506,544 F347S probably damaging Het
Rrp12 A T 19: 41,870,808 probably null Het
Ryr1 A T 7: 29,071,924 L2557Q probably null Het
Slc1a7 T C 4: 108,010,300 probably benign Het
Slc35e2 T A 4: 155,611,714 M186K possibly damaging Het
Snx6 G T 12: 54,770,764 S116* probably null Het
Sptan1 T C 2: 29,994,367 probably null Het
Sucla2 T A 14: 73,592,669 M382K probably damaging Het
Susd5 T C 9: 114,057,591 L16P possibly damaging Het
Tmem260 G A 14: 48,486,801 A369T possibly damaging Het
Tmprss6 A G 15: 78,452,522 Y393H probably damaging Het
Tnrc6c A T 11: 117,722,519 Q501L probably damaging Het
Trim17 A G 11: 58,965,543 Y142C probably damaging Het
Trim65 T C 11: 116,128,282 R144G probably damaging Het
Trpm1 A G 7: 64,223,799 T601A probably benign Het
Ttn A T 2: 76,734,344 V28483E probably damaging Het
Ube2l3 G T 16: 17,201,472 probably benign Het
Ube2l3 T C 16: 17,201,476 probably null Het
Yme1l1 T C 2: 23,195,306 probably benign Het
Zfat A G 15: 68,179,957 S663P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Atp13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Atp13a3 APN 16 30351279 missense probably damaging 0.99
IGL00490:Atp13a3 APN 16 30352354 missense probably benign 0.31
IGL01844:Atp13a3 APN 16 30361963 missense probably benign 0.17
IGL01994:Atp13a3 APN 16 30337518 missense possibly damaging 0.90
IGL02057:Atp13a3 APN 16 30332364 missense probably benign
IGL02083:Atp13a3 APN 16 30347706 missense possibly damaging 0.89
IGL02348:Atp13a3 APN 16 30351228 critical splice donor site probably null
IGL02352:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02359:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02643:Atp13a3 APN 16 30333796 missense probably null
IGL02687:Atp13a3 APN 16 30337551 missense probably damaging 1.00
IGL02951:Atp13a3 APN 16 30338621 splice site probably null
IGL03190:Atp13a3 APN 16 30322948 missense probably benign 0.00
H8562:Atp13a3 UTSW 16 30359725 nonsense probably null
H8786:Atp13a3 UTSW 16 30359725 nonsense probably null
PIT4812001:Atp13a3 UTSW 16 30362578 missense probably damaging 0.98
R0725:Atp13a3 UTSW 16 30351387 missense probably damaging 1.00
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1244:Atp13a3 UTSW 16 30361836 missense probably benign 0.00
R1326:Atp13a3 UTSW 16 30352310 missense probably damaging 1.00
R1613:Atp13a3 UTSW 16 30332300 missense probably damaging 1.00
R1672:Atp13a3 UTSW 16 30332274 missense possibly damaging 0.96
R1709:Atp13a3 UTSW 16 30315841 missense probably benign 0.37
R1733:Atp13a3 UTSW 16 30357266 missense probably benign 0.35
R2086:Atp13a3 UTSW 16 30352298 missense possibly damaging 0.89
R2128:Atp13a3 UTSW 16 30354276 missense probably damaging 0.97
R2421:Atp13a3 UTSW 16 30349825 missense probably benign 0.29
R3427:Atp13a3 UTSW 16 30344593 missense probably benign 0.05
R3783:Atp13a3 UTSW 16 30354249 missense probably damaging 1.00
R4058:Atp13a3 UTSW 16 30354246 missense possibly damaging 0.94
R4059:Atp13a3 UTSW 16 30354246 missense possibly damaging 0.94
R4798:Atp13a3 UTSW 16 30341240 missense probably damaging 1.00
R5045:Atp13a3 UTSW 16 30339876 missense probably benign 0.24
R5216:Atp13a3 UTSW 16 30340284 missense probably damaging 1.00
R5704:Atp13a3 UTSW 16 30321879 missense probably benign 0.18
R5876:Atp13a3 UTSW 16 30362734 missense probably benign 0.13
R6291:Atp13a3 UTSW 16 30336243 missense probably damaging 0.99
R6324:Atp13a3 UTSW 16 30332285 missense possibly damaging 0.72
R6328:Atp13a3 UTSW 16 30336235 missense probably damaging 0.99
R6372:Atp13a3 UTSW 16 30343455 missense probably damaging 0.99
R6446:Atp13a3 UTSW 16 30361869 missense probably benign 0.00
R7016:Atp13a3 UTSW 16 30338490 missense possibly damaging 0.54
R7086:Atp13a3 UTSW 16 30351063 missense possibly damaging 0.87
R7241:Atp13a3 UTSW 16 30352277 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAAATTCCTTATCATGTCCTGGCAA -3'
(R):5'- TAACAGGTAAATTAGCAGTTGAGAAA -3'

Sequencing Primer
(F):5'- TGTCCTGGCAATAAAGTCCCAGTTAC -3'
(R):5'- CTCATCCTGTGATTGCCA -3'
Posted On2017-03-31