Incidental Mutation 'R5947:Afap1l1'
ID472260
Institutional Source Beutler Lab
Gene Symbol Afap1l1
Ensembl Gene ENSMUSG00000033032
Gene Nameactin filament associated protein 1-like 1
Synonyms
MMRRC Submission 044138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5947 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location61730261-61786702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61743700 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 361 (S361P)
Ref Sequence ENSEMBL: ENSMUSP00000113286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120472] [ENSMUST00000154876]
Predicted Effect probably damaging
Transcript: ENSMUST00000120472
AA Change: S361P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113286
Gene: ENSMUSG00000033032
AA Change: S361P

DomainStartEndE-ValueType
low complexity region 114 123 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
PH 221 318 4.13e-6 SMART
PH 419 514 9.41e-10 SMART
coiled coil region 611 701 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147278
Predicted Effect probably benign
Transcript: ENSMUST00000154876
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 123,967,998 probably null Het
Abt1 T C 13: 23,422,055 E243G possibly damaging Het
Alms1 T C 6: 85,619,712 S507P probably benign Het
Atp13a3 A G 16: 30,362,700 V34A probably benign Het
Atpaf2 A T 11: 60,405,882 probably benign Het
Bbs1 A C 19: 4,892,994 L456R probably benign Het
Bri3bp G T 5: 125,452,153 G84* probably null Het
Bri3bp G C 5: 125,452,154 probably benign Het
Car10 A C 11: 93,490,613 H134P probably damaging Het
Cntrl A G 2: 35,116,679 E119G probably damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Dirc2 T C 16: 35,730,306 T308A probably benign Het
Dppa4 T C 16: 48,291,108 V100A possibly damaging Het
Elmo1 G T 13: 20,290,383 E105* probably null Het
Esrp2 T G 8: 106,132,933 probably benign Het
Exoc3l4 A G 12: 111,422,401 K108R possibly damaging Het
Exph5 G A 9: 53,375,222 R1201H probably benign Het
Galnt3 A C 2: 66,084,156 probably benign Het
Gm14486 C T 2: 30,658,801 noncoding transcript Het
Gna12 T A 5: 140,760,962 I243F probably damaging Het
Itga5 A T 15: 103,356,785 W232R probably damaging Het
Lekr1 A T 3: 65,773,077 noncoding transcript Het
Lrp1 C T 10: 127,589,554 probably null Het
Mast4 T C 13: 102,735,640 M2215V probably benign Het
Mfap5 T C 6: 122,525,986 Y52H probably damaging Het
Mrps31 A G 8: 22,414,975 K127E possibly damaging Het
Mto1 C T 9: 78,461,029 T485M probably damaging Het
Mybbp1a G A 11: 72,442,431 C107Y probably damaging Het
Nedd4 G A 9: 72,730,850 probably benign Het
Nek2 A G 1: 191,829,485 E360G probably benign Het
Notch1 T A 2: 26,462,528 probably benign Het
Nubp1 T C 16: 10,420,186 probably benign Het
Pcdhb1 G A 18: 37,266,673 R559H possibly damaging Het
Pdcd11 G A 19: 47,129,263 V1684I probably benign Het
Pggt1b G T 18: 46,248,940 N258K probably benign Het
Pou6f1 C T 15: 100,586,120 V166M possibly damaging Het
Pprc1 A G 19: 46,063,672 D546G possibly damaging Het
Psapl1 T C 5: 36,204,307 V81A probably benign Het
Rin2 T A 2: 145,844,943 probably benign Het
Rpf1 A G 3: 146,506,544 F347S probably damaging Het
Rrp12 A T 19: 41,870,808 probably null Het
Ryr1 A T 7: 29,071,924 L2557Q probably null Het
Slc1a7 T C 4: 108,010,300 probably benign Het
Slc35e2 T A 4: 155,611,714 M186K possibly damaging Het
Snx6 G T 12: 54,770,764 S116* probably null Het
Sptan1 T C 2: 29,994,367 probably null Het
Sucla2 T A 14: 73,592,669 M382K probably damaging Het
Susd5 T C 9: 114,057,591 L16P possibly damaging Het
Tmem260 G A 14: 48,486,801 A369T possibly damaging Het
Tmprss6 A G 15: 78,452,522 Y393H probably damaging Het
Tnrc6c A T 11: 117,722,519 Q501L probably damaging Het
Trim17 A G 11: 58,965,543 Y142C probably damaging Het
Trim65 T C 11: 116,128,282 R144G probably damaging Het
Trpm1 A G 7: 64,223,799 T601A probably benign Het
Ttn A T 2: 76,734,344 V28483E probably damaging Het
Ube2l3 G T 16: 17,201,472 probably benign Het
Ube2l3 T C 16: 17,201,476 probably null Het
Yme1l1 T C 2: 23,195,306 probably benign Het
Zfat A G 15: 68,179,957 S663P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Afap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Afap1l1 APN 18 61736854 missense probably benign 0.04
IGL01643:Afap1l1 APN 18 61751826 missense probably damaging 1.00
IGL01754:Afap1l1 APN 18 61737494 critical splice donor site probably null
IGL01945:Afap1l1 APN 18 61756863 missense probably benign 0.00
IGL02025:Afap1l1 APN 18 61733699 splice site probably benign
IGL02413:Afap1l1 APN 18 61733789 missense probably benign 0.00
IGL02418:Afap1l1 APN 18 61752577 missense probably damaging 1.00
IGL02493:Afap1l1 APN 18 61737523 missense possibly damaging 0.83
IGL02888:Afap1l1 APN 18 61748808 missense probably damaging 1.00
IGL03010:Afap1l1 APN 18 61743319 missense probably benign 0.01
IGL03122:Afap1l1 APN 18 61733831 missense probably benign
IGL03145:Afap1l1 APN 18 61741809 missense possibly damaging 0.93
IGL03052:Afap1l1 UTSW 18 61748823 missense probably benign 0.00
R0008:Afap1l1 UTSW 18 61756905 missense probably benign 0.11
R0008:Afap1l1 UTSW 18 61756905 missense probably benign 0.11
R0217:Afap1l1 UTSW 18 61746869 missense probably damaging 1.00
R0421:Afap1l1 UTSW 18 61751874 missense probably damaging 1.00
R0626:Afap1l1 UTSW 18 61739220 missense probably benign 0.07
R0963:Afap1l1 UTSW 18 61736930 missense probably damaging 1.00
R1403:Afap1l1 UTSW 18 61741838 missense probably damaging 1.00
R1403:Afap1l1 UTSW 18 61741838 missense probably damaging 1.00
R1566:Afap1l1 UTSW 18 61755643 missense probably benign
R1572:Afap1l1 UTSW 18 61737499 missense probably damaging 1.00
R1854:Afap1l1 UTSW 18 61743294 missense probably benign
R1992:Afap1l1 UTSW 18 61741771 nonsense probably null
R2063:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2064:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2065:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2066:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R4120:Afap1l1 UTSW 18 61739172 missense probably damaging 1.00
R4904:Afap1l1 UTSW 18 61738715 missense probably benign 0.00
R4997:Afap1l1 UTSW 18 61751808 missense probably benign
R5379:Afap1l1 UTSW 18 61758650 missense probably damaging 1.00
R6774:Afap1l1 UTSW 18 61755661 missense probably benign 0.00
R6814:Afap1l1 UTSW 18 61733741 missense probably benign 0.45
R7085:Afap1l1 UTSW 18 61748814 missense possibly damaging 0.91
R7325:Afap1l1 UTSW 18 61736846 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CTTGCAACCTGCCTGTAATTACTAG -3'
(R):5'- TGGAGTGTCTAAGTCATTGCC -3'

Sequencing Primer
(F):5'- GCCTGTAATTACTAGATATGAAAGGC -3'
(R):5'- CATATTGGCGTGTCGTCAGATACAC -3'
Posted On2017-03-31