Incidental Mutation 'R5948:Vps37a'
ID472282
Institutional Source Beutler Lab
Gene Symbol Vps37a
Ensembl Gene ENSMUSG00000031600
Gene Namevacuolar protein sorting 37A
SynonymsD8Ertd531e, 4930592A21Rik, 2210018P21Rik
MMRRC Submission 043244-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R5948 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40511783-40551134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40540711 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 249 (E249G)
Ref Sequence ENSEMBL: ENSMUSP00000096415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098817
AA Change: E249G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600
AA Change: E249G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Blast:UBCc 29 128 6e-6 BLAST
low complexity region 155 164 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Pfam:Mod_r 235 380 2.7e-39 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the VPS37 family, and encodes a component of the ESCRT-I (endosomal sorting complex required for transport I) protein complex, required for the sorting of ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies. Expression of this gene is downregulated in hepatocellular carcinoma, and mutations in this gene are associated with autosomal recessive spastic paraplegia-53. A related pseudogene has been identified on chromosome 5. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 T C 3: 37,083,355 probably null Het
Adam8 G T 7: 139,987,884 D341E probably benign Het
Ankrd6 T C 4: 32,817,075 T351A possibly damaging Het
Ccdc150 T C 1: 54,277,714 S251P possibly damaging Het
Cfh T C 1: 140,108,808 N629S probably damaging Het
Col4a2 T C 8: 11,420,600 S453P probably benign Het
Csf2 T C 11: 54,247,688 D109G probably benign Het
Dapk1 C A 13: 60,729,395 H483N probably damaging Het
Dnah7c T G 1: 46,672,497 I2628R probably benign Het
Dsp T C 13: 38,195,401 Y2041H possibly damaging Het
Dusp10 A G 1: 184,068,876 N280S probably benign Het
Efhc1 T A 1: 20,972,828 Y324N probably damaging Het
Epsti1 T C 14: 77,939,890 L170P probably damaging Het
Fbn2 C T 18: 58,037,049 G2217R probably damaging Het
Fryl A G 5: 73,097,372 probably null Het
Mrpl39 T C 16: 84,725,153 N244D probably benign Het
Nptxr C T 15: 79,789,841 A445T probably benign Het
Olfr344 A G 2: 36,569,351 Y251C probably damaging Het
Otud3 A G 4: 138,897,614 Y259H probably benign Het
Parvb G A 15: 84,303,461 V257M probably damaging Het
Piezo1 T C 8: 122,483,347 E2258G probably benign Het
Prpf8 A G 11: 75,509,189 E2303G possibly damaging Het
Psmc6 A G 14: 45,334,657 D88G probably benign Het
Rbbp6 C T 7: 122,997,628 T701I probably damaging Het
Rtl1 T A 12: 109,590,599 D1602V possibly damaging Het
Rubcnl T C 14: 75,047,616 L525P probably damaging Het
Sbf2 T C 7: 110,489,285 D73G probably damaging Het
Sh3tc2 T A 18: 62,013,105 M1185K probably damaging Het
Shank2 A G 7: 144,407,223 K469E probably damaging Het
Ttc41 T C 10: 86,713,224 L94P probably damaging Het
Ttf1 G A 2: 29,073,920 A603T possibly damaging Het
Usp9y A T Y: 1,324,996 H1686Q possibly damaging Het
Zfp273 A G 13: 67,825,799 I316V probably benign Het
Zfp600 T A 4: 146,195,075 N104K probably damaging Het
Other mutations in Vps37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Vps37a APN 8 40540738 missense probably benign 0.00
IGL01963:Vps37a APN 8 40540730 missense probably damaging 0.99
PIT4377001:Vps37a UTSW 8 40537046 missense possibly damaging 0.71
R0090:Vps37a UTSW 8 40526989 missense possibly damaging 0.92
R1106:Vps37a UTSW 8 40512206 missense probably damaging 1.00
R1815:Vps37a UTSW 8 40512121 missense probably benign
R3612:Vps37a UTSW 8 40544936 splice site probably benign
R5775:Vps37a UTSW 8 40529119 missense probably damaging 1.00
R6048:Vps37a UTSW 8 40528322 missense probably damaging 1.00
R6337:Vps37a UTSW 8 40540708 missense probably benign 0.10
R6715:Vps37a UTSW 8 40540861 intron probably null
Predicted Primers PCR Primer
(F):5'- TGACTCAGGCTTGCTCTCTG -3'
(R):5'- TTCCAAGCTATGTTCCAAAAGGAG -3'

Sequencing Primer
(F):5'- TGCGGCCTACTCTACAAAGG -3'
(R):5'- TTTTTCCTGGAAGATAAATCTCTGC -3'
Posted On2017-03-31