Mutagenetix > Incidental Mutation

Incidental Mutation 'R5948:Prpf8'

472287

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

043244-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R5948 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75377642-75400275 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75400015 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2303 (E2303G)

Ref Sequence

ENSEMBL: ENSMUSP00000099568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000042808] [ENSMUST00000042972] [ENSMUST00000102510] [ENSMUST00000118243] [ENSMUST00000123819]

AlphaFold

Q99PV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018449
AA Change: E2303G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: E2303G

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000042808

SMART Domains

Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF	54	90	2.16e1	SMART
EGF	101	133	1.36e1	SMART
EGF_like	165	193	4.55e1	SMART
EGF_Lam	225	263	8.78e-2	SMART
EGF_like	262	296	4.93e1	SMART
EGF	307	341	2.69e1	SMART
EGF	352	384	2.25e1	SMART
transmembrane domain	424	446	N/A	INTRINSIC
low complexity region	520	535	N/A	INTRINSIC
low complexity region	791	805	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000042972

SMART Domains

Protein: ENSMUSP00000037238
Gene: ENSMUSG00000038195

Domain	Start	End	E-Value	Type
low complexity region	14	24	N/A	INTRINSIC
Pfam:Jnk-SapK_ap_N	27	195	2.1e-16	PFAM
Pfam:RILP	223	281	1.1e-21	PFAM
low complexity region	289	298	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102510
AA Change: E2303G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: E2303G

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118243

SMART Domains

Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF	54	90	2.16e1	SMART
EGF	101	133	1.36e1	SMART
EGF_like	165	193	4.55e1	SMART
EGF_Lam	225	263	8.78e-2	SMART
EGF_like	262	296	4.93e1	SMART
EGF	307	341	2.69e1	SMART
EGF	352	384	2.25e1	SMART
transmembrane domain	424	446	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156923

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad1	T	C	3: 37,137,504 (GRCm39)		probably null	Het
Adam8	G	T	7: 139,567,797 (GRCm39)	D341E	probably benign	Het
Ankrd6	T	C	4: 32,817,075 (GRCm39)	T351A	possibly damaging	Het
Ccdc150	T	C	1: 54,316,873 (GRCm39)	S251P	possibly damaging	Het
Cfh	T	C	1: 140,036,546 (GRCm39)	N629S	probably damaging	Het
Col4a2	T	C	8: 11,470,600 (GRCm39)	S453P	probably benign	Het
Csf2	T	C	11: 54,138,514 (GRCm39)	D109G	probably benign	Het
Dapk1	C	A	13: 60,877,209 (GRCm39)	H483N	probably damaging	Het
Dnah7c	T	G	1: 46,711,657 (GRCm39)	I2628R	probably benign	Het
Dsp	T	C	13: 38,379,377 (GRCm39)	Y2041H	possibly damaging	Het
Dusp10	A	G	1: 183,801,073 (GRCm39)	N280S	probably benign	Het
Efhc1	T	A	1: 21,043,052 (GRCm39)	Y324N	probably damaging	Het
Epsti1	T	C	14: 78,177,330 (GRCm39)	L170P	probably damaging	Het
Fbn2	C	T	18: 58,170,121 (GRCm39)	G2217R	probably damaging	Het
Fryl	A	G	5: 73,254,715 (GRCm39)		probably null	Het
Mrpl39	T	C	16: 84,522,041 (GRCm39)	N244D	probably benign	Het
Nptxr	C	T	15: 79,674,042 (GRCm39)	A445T	probably benign	Het
Or1j15	A	G	2: 36,459,363 (GRCm39)	Y251C	probably damaging	Het
Otud3	A	G	4: 138,624,925 (GRCm39)	Y259H	probably benign	Het
Parvb	G	A	15: 84,187,662 (GRCm39)	V257M	probably damaging	Het
Piezo1	T	C	8: 123,210,086 (GRCm39)	E2258G	probably benign	Het
Psmc6	A	G	14: 45,572,114 (GRCm39)	D88G	probably benign	Het
Rbbp6	C	T	7: 122,596,851 (GRCm39)	T701I	probably damaging	Het
Rtl1	T	A	12: 109,557,033 (GRCm39)	D1602V	possibly damaging	Het
Rubcnl	T	C	14: 75,285,056 (GRCm39)	L525P	probably damaging	Het
Sbf2	T	C	7: 110,088,492 (GRCm39)	D73G	probably damaging	Het
Sh3tc2	T	A	18: 62,146,176 (GRCm39)	M1185K	probably damaging	Het
Shank2	A	G	7: 143,960,960 (GRCm39)	K469E	probably damaging	Het
Ttc41	T	C	10: 86,549,088 (GRCm39)	L94P	probably damaging	Het
Ttf1	G	A	2: 28,963,932 (GRCm39)	A603T	possibly damaging	Het
Usp9y	A	T	Y: 1,324,996 (GRCm39)	H1686Q	possibly damaging	Het
Vps37a	A	G	8: 40,993,752 (GRCm39)	E249G	possibly damaging	Het
Zfp273	A	G	13: 67,973,918 (GRCm39)	I316V	probably benign	Het
Zfp600	T	A	4: 146,131,645 (GRCm39)	N104K	probably damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75,386,472 (GRCm39)	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75,381,232 (GRCm39)	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75,386,570 (GRCm39)	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75,390,818 (GRCm39)	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75,392,660 (GRCm39)	nonsense	probably null
IGL02077:Prpf8	APN	11	75,386,635 (GRCm39)	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75,381,498 (GRCm39)	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75,400,084 (GRCm39)	missense	probably benign	0.32
cutter	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
BB009:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75,387,181 (GRCm39)	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75,397,188 (GRCm39)	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75,396,075 (GRCm39)	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75,392,768 (GRCm39)	splice site	probably benign
R0573:Prpf8	UTSW	11	75,381,480 (GRCm39)	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75,394,270 (GRCm39)	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75,384,775 (GRCm39)	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75,385,256 (GRCm39)	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75,399,500 (GRCm39)	unclassified	probably benign
R1123:Prpf8	UTSW	11	75,386,111 (GRCm39)	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75,386,249 (GRCm39)	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75,395,570 (GRCm39)	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75,387,337 (GRCm39)	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75,378,547 (GRCm39)	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75,381,357 (GRCm39)	missense	probably benign
R2185:Prpf8	UTSW	11	75,377,939 (GRCm39)	nonsense	probably null
R2271:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75,386,860 (GRCm39)	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75,397,547 (GRCm39)	splice site	probably null
R3893:Prpf8	UTSW	11	75,391,083 (GRCm39)	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75,381,528 (GRCm39)	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75,383,331 (GRCm39)	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75,400,054 (GRCm39)	splice site	probably null
R5186:Prpf8	UTSW	11	75,380,609 (GRCm39)	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75,391,030 (GRCm39)	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75,397,236 (GRCm39)	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75,399,784 (GRCm39)	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75,394,469 (GRCm39)	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75,394,464 (GRCm39)	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75,395,927 (GRCm39)	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75,395,564 (GRCm39)	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75,391,734 (GRCm39)	missense	possibly damaging	0.87
R6073:Prpf8	UTSW	11	75,384,848 (GRCm39)	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75,384,334 (GRCm39)	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75,382,321 (GRCm39)	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
R6804:Prpf8	UTSW	11	75,390,635 (GRCm39)	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75,381,562 (GRCm39)	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75,395,654 (GRCm39)	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75,386,984 (GRCm39)	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75,399,374 (GRCm39)	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75,381,226 (GRCm39)	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75,394,181 (GRCm39)	nonsense	probably null
R7182:Prpf8	UTSW	11	75,381,553 (GRCm39)	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75,384,783 (GRCm39)	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75,382,610 (GRCm39)	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75,399,738 (GRCm39)	nonsense	probably null
R7522:Prpf8	UTSW	11	75,400,102 (GRCm39)	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75,399,200 (GRCm39)	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75,382,330 (GRCm39)	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75,391,022 (GRCm39)	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75,399,732 (GRCm39)	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75,385,300 (GRCm39)	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75,393,368 (GRCm39)	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75,390,976 (GRCm39)	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75,390,641 (GRCm39)	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75,382,600 (GRCm39)	nonsense	probably null
R8823:Prpf8	UTSW	11	75,384,282 (GRCm39)	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75,386,870 (GRCm39)	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75,380,589 (GRCm39)	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75,387,340 (GRCm39)	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75,397,212 (GRCm39)	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75,394,486 (GRCm39)	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75,385,608 (GRCm39)	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75,385,681 (GRCm39)	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75,394,257 (GRCm39)	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75,397,590 (GRCm39)	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75,394,160 (GRCm39)	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- AGGGTTCAGATGCTCCTGTC -3'
(R):5'- ATGTCAGCAGCTTGTCTGGG -3'

Sequencing Primer
(F):5'- CCTGGAACTACAACTTTATGGGTACG -3'
(R):5'- CTGGGGAGGGCGTTCAAG -3'

Posted On

2017-03-31