Incidental Mutation 'R5950:Zc3h6'
ID472367
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Namezinc finger CCCH type containing 6
Synonyms
MMRRC Submission 044140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R5950 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128967402-129018563 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 128997790 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 174 (Y174*)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110319] [ENSMUST00000110320]
Predicted Effect probably benign
Transcript: ENSMUST00000110319
SMART Domains Protein: ENSMUSP00000105948
Gene: ENSMUSG00000042851

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110320
AA Change: Y174*
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: Y174*

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Meta Mutation Damage Score 0.6484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 93% (75/81)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T A 17: 28,905,755 Q256L possibly damaging Het
Abca15 G A 7: 120,382,656 G1065R probably damaging Het
Acox2 A T 14: 8,255,793 Y113N probably benign Het
Arid4b T A 13: 14,191,264 probably benign Het
Atf6 C T 1: 170,834,879 G271R probably damaging Het
Cct8l1 C A 5: 25,517,743 F485L probably benign Het
Cdk5r2 A G 1: 74,855,402 E102G probably damaging Het
Celsr1 A T 15: 86,032,500 V424E probably damaging Het
Ces1h T C 8: 93,362,959 T271A probably benign Het
Cfap44 T C 16: 44,479,847 I1738T probably damaging Het
Cntnap3 G A 13: 64,787,769 L427F probably damaging Het
Crybg3 T C 16: 59,493,571 probably benign Het
Dis3l2 A G 1: 87,021,108 D589G probably damaging Het
Dlg1 A G 16: 31,665,583 R10G probably damaging Het
Dnajc1 A C 2: 18,306,941 probably benign Het
Dpy19l2 T A 9: 24,581,134 T723S probably benign Het
Dsg3 A T 18: 20,538,529 N764Y probably damaging Het
Dst G T 1: 34,262,060 R3654L probably damaging Het
Evl C T 12: 108,675,553 T198I probably benign Het
Hectd2 A G 19: 36,597,239 probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Igsf5 T C 16: 96,372,872 V34A probably benign Het
Ikzf2 A T 1: 69,683,244 N41K probably damaging Het
Kif6 G T 17: 49,715,088 A339S probably damaging Het
Klhl1 T A 14: 96,240,354 D426V probably damaging Het
Knop1 A C 7: 118,853,334 V54G probably damaging Het
Lama4 T A 10: 39,030,448 V270D probably benign Het
Lnx2 A G 5: 147,024,350 probably null Het
Lrp5 A T 19: 3,602,333 V1179E probably benign Het
Lrpprc T G 17: 84,740,170 D878A possibly damaging Het
Lrrc14 A T 15: 76,715,310 probably benign Het
Ltbp1 A T 17: 75,273,870 D660V probably damaging Het
Macf1 C G 4: 123,439,436 probably null Het
Map3k21 C A 8: 125,941,760 T695K possibly damaging Het
Mcm3ap T A 10: 76,488,419 D895E possibly damaging Het
Mfsd7a A T 5: 108,445,485 H162Q probably damaging Het
Mink1 T A 11: 70,609,586 D779E possibly damaging Het
Mkrn3 T C 7: 62,419,719 E108G probably damaging Het
Nars A G 18: 64,510,485 V141A possibly damaging Het
Olfr954 T C 9: 39,462,337 V299A probably benign Het
Pard3b T A 1: 62,216,531 Y572N probably benign Het
Pcnx3 A C 19: 5,667,158 M1599R possibly damaging Het
Pitx2 A G 3: 129,218,520 S180G probably damaging Het
Pkd2l1 A C 19: 44,152,090 V608G probably benign Het
Pkhd1l1 A G 15: 44,532,965 D1961G probably benign Het
Pxylp1 T C 9: 96,839,126 T109A probably damaging Het
Rai1 T A 11: 60,187,593 C828S probably damaging Het
Ralgapa1 T A 12: 55,738,265 T737S possibly damaging Het
Scn11a A G 9: 119,811,124 V235A probably damaging Het
Sfxn1 A T 13: 54,091,287 T134S probably benign Het
Skint1 A G 4: 112,019,335 Y151C probably benign Het
Slc11a1 G T 1: 74,377,176 W54L probably benign Het
Soga3 T C 10: 29,143,648 probably benign Het
Synpo2l T A 14: 20,665,935 Q191L probably benign Het
Tank A G 2: 61,653,569 probably benign Het
Tctex1d1 T G 4: 103,004,250 L147R probably damaging Het
Terb1 A T 8: 104,488,485 probably null Het
Trdc T C 14: 54,144,311 probably benign Het
Tsen34 A G 7: 3,694,788 I63V probably null Het
Ust T C 10: 8,248,101 H257R probably benign Het
Vmn2r6 T C 3: 64,565,231 Q23R probably benign Het
Wdr93 A T 7: 79,773,431 H481L probably damaging Het
Xirp2 A G 2: 67,511,320 T1302A possibly damaging Het
Zcchc7 T G 4: 44,931,244 D144E possibly damaging Het
Zfp472 T A 17: 32,977,507 H185Q possibly damaging Het
Zfp523 C A 17: 28,202,558 P66H probably benign Het
Zfp712 A T 13: 67,044,817 L57Q probably damaging Het
Zik1 G A 7: 10,490,571 Q200* probably null Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 unclassified probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCCCTAGCATAGACGTATATCAG -3'
(R):5'- GGTCTACACGGTACAGAAACATG -3'

Sequencing Primer
(F):5'- GACGTATATCAGGAAGTTACATGAC -3'
(R):5'- GAAGCCACAAGAATGAGCTAATTTTG -3'
Posted On2017-03-31