Incidental Mutation 'R5950:Abca15'
ID472385
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene NameATP-binding cassette, sub-family A (ABC1), member 15
Synonyms4930500I12Rik
MMRRC Submission 044140-MU
Accession Numbers

NCBI RefSeq: NM_177213.3; MGI:2388709

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5950 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120328670-120407687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120382656 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1065 (G1065R)
Ref Sequence ENSEMBL: ENSMUSP00000112821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265]
Predicted Effect probably damaging
Transcript: ENSMUST00000076272
AA Change: G1065R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: G1065R

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121265
AA Change: G1065R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: G1065R

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Meta Mutation Damage Score 0.0404 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 93% (75/81)
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T A 17: 28,905,755 Q256L possibly damaging Het
Acox2 A T 14: 8,255,793 Y113N probably benign Het
Arid4b T A 13: 14,191,264 probably benign Het
Atf6 C T 1: 170,834,879 G271R probably damaging Het
Cct8l1 C A 5: 25,517,743 F485L probably benign Het
Cdk5r2 A G 1: 74,855,402 E102G probably damaging Het
Celsr1 A T 15: 86,032,500 V424E probably damaging Het
Ces1h T C 8: 93,362,959 T271A probably benign Het
Cfap44 T C 16: 44,479,847 I1738T probably damaging Het
Cntnap3 G A 13: 64,787,769 L427F probably damaging Het
Crybg3 T C 16: 59,493,571 probably benign Het
Dis3l2 A G 1: 87,021,108 D589G probably damaging Het
Dlg1 A G 16: 31,665,583 R10G probably damaging Het
Dnajc1 A C 2: 18,306,941 probably benign Het
Dpy19l2 T A 9: 24,581,134 T723S probably benign Het
Dsg3 A T 18: 20,538,529 N764Y probably damaging Het
Dst G T 1: 34,262,060 R3654L probably damaging Het
Evl C T 12: 108,675,553 T198I probably benign Het
Hectd2 A G 19: 36,597,239 probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Igsf5 T C 16: 96,372,872 V34A probably benign Het
Ikzf2 A T 1: 69,683,244 N41K probably damaging Het
Kif6 G T 17: 49,715,088 A339S probably damaging Het
Klhl1 T A 14: 96,240,354 D426V probably damaging Het
Knop1 A C 7: 118,853,334 V54G probably damaging Het
Lama4 T A 10: 39,030,448 V270D probably benign Het
Lnx2 A G 5: 147,024,350 probably null Het
Lrp5 A T 19: 3,602,333 V1179E probably benign Het
Lrpprc T G 17: 84,740,170 D878A possibly damaging Het
Lrrc14 A T 15: 76,715,310 probably benign Het
Ltbp1 A T 17: 75,273,870 D660V probably damaging Het
Macf1 C G 4: 123,439,436 probably null Het
Map3k21 C A 8: 125,941,760 T695K possibly damaging Het
Mcm3ap T A 10: 76,488,419 D895E possibly damaging Het
Mfsd7a A T 5: 108,445,485 H162Q probably damaging Het
Mink1 T A 11: 70,609,586 D779E possibly damaging Het
Mkrn3 T C 7: 62,419,719 E108G probably damaging Het
Nars A G 18: 64,510,485 V141A possibly damaging Het
Olfr954 T C 9: 39,462,337 V299A probably benign Het
Pard3b T A 1: 62,216,531 Y572N probably benign Het
Pcnx3 A C 19: 5,667,158 M1599R possibly damaging Het
Pitx2 A G 3: 129,218,520 S180G probably damaging Het
Pkd2l1 A C 19: 44,152,090 V608G probably benign Het
Pkhd1l1 A G 15: 44,532,965 D1961G probably benign Het
Pxylp1 T C 9: 96,839,126 T109A probably damaging Het
Rai1 T A 11: 60,187,593 C828S probably damaging Het
Ralgapa1 T A 12: 55,738,265 T737S possibly damaging Het
Scn11a A G 9: 119,811,124 V235A probably damaging Het
Sfxn1 A T 13: 54,091,287 T134S probably benign Het
Skint1 A G 4: 112,019,335 Y151C probably benign Het
Slc11a1 G T 1: 74,377,176 W54L probably benign Het
Soga3 T C 10: 29,143,648 probably benign Het
Synpo2l T A 14: 20,665,935 Q191L probably benign Het
Tank A G 2: 61,653,569 probably benign Het
Tctex1d1 T G 4: 103,004,250 L147R probably damaging Het
Terb1 A T 8: 104,488,485 probably null Het
Trdc T C 14: 54,144,311 probably benign Het
Tsen34 A G 7: 3,694,788 I63V probably null Het
Ust T C 10: 8,248,101 H257R probably benign Het
Vmn2r6 T C 3: 64,565,231 Q23R probably benign Het
Wdr93 A T 7: 79,773,431 H481L probably damaging Het
Xirp2 A G 2: 67,511,320 T1302A possibly damaging Het
Zc3h6 C A 2: 128,997,790 Y174* probably null Het
Zcchc7 T G 4: 44,931,244 D144E possibly damaging Het
Zfp472 T A 17: 32,977,507 H185Q possibly damaging Het
Zfp523 C A 17: 28,202,558 P66H probably benign Het
Zfp712 A T 13: 67,044,817 L57Q probably damaging Het
Zik1 G A 7: 10,490,571 Q200* probably null Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 120397054 missense probably damaging 1.00
IGL00505:Abca15 APN 7 120369236 critical splice donor site probably null
IGL00851:Abca15 APN 7 120340007 missense probably damaging 1.00
IGL00985:Abca15 APN 7 120397018 missense probably damaging 1.00
IGL01114:Abca15 APN 7 120361420 missense probably damaging 0.99
IGL01287:Abca15 APN 7 120332858 utr 3 prime probably benign
IGL01333:Abca15 APN 7 120382308 missense probably damaging 1.00
IGL01482:Abca15 APN 7 120382746 missense probably benign 0.00
IGL01610:Abca15 APN 7 120340644 missense probably damaging 0.98
IGL02238:Abca15 APN 7 120396606 missense probably benign 0.02
IGL02377:Abca15 APN 7 120365910 splice site probably benign
IGL02666:Abca15 APN 7 120335208 missense probably damaging 1.00
IGL02836:Abca15 APN 7 120388216 missense probably benign
IGL03337:Abca15 APN 7 120396707 missense probably benign 0.24
IGL03354:Abca15 APN 7 120394488 nonsense probably null
H8562:Abca15 UTSW 7 120374854 splice site probably benign
IGL03098:Abca15 UTSW 7 120388276 splice site probably null
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0076:Abca15 UTSW 7 120373685 splice site probably benign
R0165:Abca15 UTSW 7 120350903 splice site probably benign
R0311:Abca15 UTSW 7 120402904 missense probably damaging 0.98
R0387:Abca15 UTSW 7 120332852 critical splice donor site probably null
R0610:Abca15 UTSW 7 120365786 missense possibly damaging 0.75
R0612:Abca15 UTSW 7 120337255 missense probably damaging 1.00
R0704:Abca15 UTSW 7 120354523 missense probably damaging 0.98
R0890:Abca15 UTSW 7 120373713 missense probably benign 0.01
R0961:Abca15 UTSW 7 120360985 nonsense probably null
R1144:Abca15 UTSW 7 120360860 splice site probably benign
R1412:Abca15 UTSW 7 120345323 missense possibly damaging 0.93
R1419:Abca15 UTSW 7 120374902 missense probably benign 0.10
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1493:Abca15 UTSW 7 120382290 missense probably benign 0.00
R1513:Abca15 UTSW 7 120340099 missense probably damaging 0.96
R1702:Abca15 UTSW 7 120382702 missense probably benign 0.10
R1857:Abca15 UTSW 7 120361369 missense probably damaging 1.00
R1893:Abca15 UTSW 7 120340553 missense possibly damaging 0.85
R1901:Abca15 UTSW 7 120346099 missense probably damaging 1.00
R1951:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1953:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1962:Abca15 UTSW 7 120341245 missense probably damaging 1.00
R2063:Abca15 UTSW 7 120360904 missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120407474 missense probably damaging 1.00
R2145:Abca15 UTSW 7 120354478 missense probably benign 0.08
R2182:Abca15 UTSW 7 120340227 nonsense probably null
R2425:Abca15 UTSW 7 120359810 missense probably damaging 1.00
R2444:Abca15 UTSW 7 120365897 missense probably damaging 1.00
R3023:Abca15 UTSW 7 120382779 missense probably benign 0.40
R3079:Abca15 UTSW 7 120385169 missense probably damaging 1.00
R3106:Abca15 UTSW 7 120396633 missense possibly damaging 0.63
R3622:Abca15 UTSW 7 120350813 nonsense probably null
R4085:Abca15 UTSW 7 120382726 missense probably damaging 1.00
R4233:Abca15 UTSW 7 120402979 nonsense probably null
R4591:Abca15 UTSW 7 120382413 missense probably damaging 1.00
R4612:Abca15 UTSW 7 120335161 missense probably benign 0.03
R4721:Abca15 UTSW 7 120350775 missense probably benign 0.01
R4838:Abca15 UTSW 7 120345300 missense probably benign 0.00
R4940:Abca15 UTSW 7 120332694 missense probably benign
R4963:Abca15 UTSW 7 120360919 missense probably damaging 1.00
R4993:Abca15 UTSW 7 120401718 missense probably damaging 0.99
R5022:Abca15 UTSW 7 120346096 missense probably damaging 0.98
R5030:Abca15 UTSW 7 120340001 missense probably damaging 1.00
R5072:Abca15 UTSW 7 120406975 missense probably damaging 1.00
R5090:Abca15 UTSW 7 120385199 missense probably damaging 1.00
R5309:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5310:Abca15 UTSW 7 120332616 missense possibly damaging 0.46
R5312:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5482:Abca15 UTSW 7 120369147 missense probably damaging 1.00
R5596:Abca15 UTSW 7 120401749 missense possibly damaging 0.94
R5853:Abca15 UTSW 7 120340583 missense probably benign 0.00
R5953:Abca15 UTSW 7 120361018 missense probably damaging 1.00
R6072:Abca15 UTSW 7 120388258 missense probably damaging 0.98
R6131:Abca15 UTSW 7 120340205 missense probably benign 0.03
R6132:Abca15 UTSW 7 120361420 missense probably benign 0.14
R6136:Abca15 UTSW 7 120340049 missense possibly damaging 0.81
R6207:Abca15 UTSW 7 120373794 missense probably benign 0.01
R6315:Abca15 UTSW 7 120346092 missense probably damaging 1.00
R6417:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6420:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6595:Abca15 UTSW 7 120394487 missense probably benign 0.00
R6653:Abca15 UTSW 7 120346006 missense probably benign 0.03
R6859:Abca15 UTSW 7 120402994 nonsense probably null
R6983:Abca15 UTSW 7 120354463 missense probably benign 0.26
R7127:Abca15 UTSW 7 120332602 missense probably benign 0.06
R7205:Abca15 UTSW 7 120394364 missense possibly damaging 0.89
R7336:Abca15 UTSW 7 120388233 missense possibly damaging 0.66
R7426:Abca15 UTSW 7 120345998 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGTTCTGATGCTTCCATAACAGTC -3'
(R):5'- CACTCACCAGTAGGAAGCAG -3'

Sequencing Primer
(F):5'- GTCTTCAATAAACCTCAGCCAAG -3'
(R):5'- CACCAGTAGGAAGCAGCAAGAAATG -3'
Posted On2017-03-31