Incidental Mutation 'R5278:Tesk2'
ID472484
Institutional Source Beutler Lab
Gene Symbol Tesk2
Ensembl Gene ENSMUSG00000033985
Gene Nametestis-specific kinase 2
Synonyms
MMRRC Submission 042865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5278 (G1)
Quality Score20
Status Validated
Chromosome4
Chromosomal Location116720948-116805956 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 116805936 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030451] [ENSMUST00000045542] [ENSMUST00000102699] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459] [ENSMUST00000130359] [ENSMUST00000145468]
Predicted Effect probably benign
Transcript: ENSMUST00000030451
SMART Domains Protein: ENSMUSP00000030451
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 39 171 3.1e-46 PFAM
Pfam:CAF1 164 452 9.9e-40 PFAM
Pfam:zf-CCCH 297 322 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045542
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102699
SMART Domains Protein: ENSMUSP00000099760
Gene: ENSMUSG00000028687

DomainStartEndE-ValueType
ENDO3c 107 259 1.46e-52 SMART
FES 260 280 2.16e-5 SMART
Pfam:NUDIX_4 353 463 2.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106455
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106456
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106459
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124857
Predicted Effect probably benign
Transcript: ENSMUST00000130359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142529
Predicted Effect probably benign
Transcript: ENSMUST00000145468
SMART Domains Protein: ENSMUSP00000117019
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
Pfam:CAF1 1 184 2.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154945
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 C T 5: 35,588,156 probably benign Het
Acvr2b G A 9: 119,432,489 V383I probably damaging Het
Akap12 T C 10: 4,354,792 M534T probably benign Het
Akp3 G A 1: 87,125,166 E26K probably benign Het
Alcam A G 16: 52,274,275 I371T probably benign Het
Ap2a1 T C 7: 44,902,779 T794A probably benign Het
Apeh G A 9: 108,091,258 P349S probably benign Het
Asb7 G T 7: 66,679,185 Q36K possibly damaging Het
Asl A G 5: 130,018,831 probably null Het
Atp13a2 T A 4: 141,000,818 I574N probably damaging Het
Bcl2l2 T A 14: 54,884,794 I138N probably damaging Het
Cacna1d C T 14: 30,352,924 probably null Het
Ccdc9 C T 7: 16,278,381 W1* probably null Het
Cdh18 T A 15: 23,474,158 S705T probably benign Het
Ces5a A T 8: 93,525,638 W209R probably damaging Het
Chpf2 T A 5: 24,588,090 probably benign Het
Cul9 T A 17: 46,510,873 H1892L probably damaging Het
Cxcl13 A G 5: 95,958,727 T53A probably benign Het
Cyp2s1 T A 7: 25,805,884 Y385F possibly damaging Het
Ddx46 A G 13: 55,676,038 E915G probably damaging Het
Dirc2 A G 16: 35,697,988 S452P probably damaging Het
Elovl3 G A 19: 46,134,101 V113I probably benign Het
Fam53c A T 18: 34,762,618 probably benign Het
Fbxw15 A T 9: 109,555,684 F349L probably benign Het
Fuz C T 7: 44,896,277 P9L probably benign Het
Igf1r C T 7: 68,193,418 T759M possibly damaging Het
Impg2 G A 16: 56,221,517 D175N probably benign Het
Jade1 G T 3: 41,589,009 R43L possibly damaging Het
Kntc1 A G 5: 123,781,014 E816G probably damaging Het
Mettl8 A T 2: 70,973,297 D262E probably damaging Het
Mrpl48 A G 7: 100,552,583 V156A probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Myh13 A G 11: 67,334,564 I252V probably benign Het
Nox4 T C 7: 87,371,926 W449R probably damaging Het
Olfr167 A T 16: 19,515,378 L86* probably null Het
Olfr437 T C 6: 43,167,721 L221P probably damaging Het
Pank4 T C 4: 154,972,165 L351P probably damaging Het
Pappa2 A T 1: 158,782,403 probably null Het
Peg10 CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC CCATCAGGATGCACATCAGGATCC 6: 4,756,442 probably benign Het
Polr3e T A 7: 120,922,961 I10K possibly damaging Het
Prkdc T C 16: 15,714,974 I1489T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sh3pxd2b A G 11: 32,381,447 D57G probably damaging Het
Shank2 G A 7: 144,068,875 probably null Het
Slc15a4 A T 5: 127,616,969 V134E probably damaging Het
Stxbp5l G T 16: 37,186,654 Q726K probably benign Het
Tex2 A G 11: 106,567,813 S264P probably benign Het
Tnik A G 3: 28,650,060 Q1003R probably damaging Het
Trip12 C T 1: 84,762,147 R628H probably damaging Het
Vmn2r69 G A 7: 85,411,783 H198Y probably benign Het
Other mutations in Tesk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Tesk2 APN 4 116771801 missense possibly damaging 0.68
IGL02051:Tesk2 APN 4 116751184 missense probably damaging 1.00
IGL02223:Tesk2 APN 4 116741825 nonsense probably null
IGL02747:Tesk2 APN 4 116802879 missense probably benign 0.31
IGL02942:Tesk2 APN 4 116771820 missense probably damaging 0.99
R1804:Tesk2 UTSW 4 116800621 unclassified probably benign
R1936:Tesk2 UTSW 4 116741824 missense probably benign 0.23
R1986:Tesk2 UTSW 4 116751193 missense probably damaging 1.00
R2414:Tesk2 UTSW 4 116801757 missense possibly damaging 0.96
R4632:Tesk2 UTSW 4 116741712 missense probably benign 0.01
R4896:Tesk2 UTSW 4 116802993 missense probably benign
R5186:Tesk2 UTSW 4 116741896 missense probably damaging 1.00
R5209:Tesk2 UTSW 4 116724698 start gained probably benign
R5769:Tesk2 UTSW 4 116802315 intron probably null
R6199:Tesk2 UTSW 4 116792170 missense probably damaging 0.98
R6464:Tesk2 UTSW 4 116802849 missense probably damaging 1.00
R6567:Tesk2 UTSW 4 116792164 missense probably damaging 1.00
R6867:Tesk2 UTSW 4 116801798 missense probably damaging 0.99
R7028:Tesk2 UTSW 4 116802687 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAAGGAACAGCGTCCGTAC -3'
(R):5'- CTGCTATGCATAGAGGAGTACG -3'

Sequencing Primer
(F):5'- TCTCATCTCCCTAGGTGGAAGG -3'
(R):5'- CGTTATAGAACCGAAGTCTGTGC -3'
Posted On2017-04-13