Incidental Mutation 'R4901:Hjurp'
ID472514
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R4901 (G1)
Quality Score217
Status Not validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GT to GTT at 88266524 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,277,657 probably null Het
Arg2 T C 12: 79,147,711 V103A probably damaging Het
Bicra T A 7: 15,987,601 T664S possibly damaging Het
Bptf A T 11: 107,110,860 Y475* probably null Het
Calcrl T C 2: 84,333,513 I445V probably benign Het
Ccdc110 G A 8: 45,943,400 R776Q probably benign Het
Ccnc A G 4: 21,727,894 N4S probably damaging Het
Ccni G A 5: 93,183,144 R323W probably damaging Het
Celsr2 T A 3: 108,406,987 M1241L possibly damaging Het
Cpd T C 11: 76,790,881 I1145M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2j8 T A 4: 96,479,086 D265V probably benign Het
Dennd2a T C 6: 39,522,687 T315A probably benign Het
Dgkz T A 2: 91,936,731 Q905L probably benign Het
Dnah8 G A 17: 30,840,714 probably null Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Gm12166 A G 11: 46,051,829 S156P probably damaging Het
Gm136 G A 4: 34,746,580 Q144* probably null Het
Gm5415 T C 1: 32,546,620 S70G probably benign Het
Gon4l T C 3: 88,908,151 V2008A possibly damaging Het
Isyna1 A T 8: 70,596,596 H414L probably damaging Het
Kif20b A G 19: 34,934,436 Y233C probably benign Het
Klk1 A T 7: 44,228,715 I132F probably damaging Het
Klre1 A T 6: 129,584,225 H183L probably benign Het
Lrp1b T C 2: 40,821,645 T3188A probably damaging Het
Mapk12 A T 15: 89,134,638 L198* probably null Het
Mt4 A C 8: 94,138,284 T29P possibly damaging Het
Myh14 C T 7: 44,661,040 V140I possibly damaging Het
Nr1h4 T C 10: 89,478,797 Q269R possibly damaging Het
Olfr1198 C G 2: 88,746,887 probably null Het
Olfr558 A G 7: 102,710,198 H313R probably benign Het
Pde1b A G 15: 103,526,685 I421V probably null Het
Pde3b A T 7: 114,508,190 T519S probably damaging Het
Phf21a T A 2: 92,357,001 C178* probably null Het
Phtf2 A G 5: 20,805,724 S88P possibly damaging Het
Pik3c3 A G 18: 30,302,929 M394V possibly damaging Het
Plxnb1 C T 9: 109,104,959 P752S probably benign Het
Pp2d1 C A 17: 53,515,009 G343V probably benign Het
Ppp6r2 A G 15: 89,259,069 I140V possibly damaging Het
Ppp6r3 C A 19: 3,467,229 V75L probably damaging Het
Ptprq T A 10: 107,688,414 H486L probably benign Het
Rasgrf1 C T 9: 89,995,003 T807M probably benign Het
Rasgrp3 C A 17: 75,514,116 Y439* probably null Het
Rbm44 A G 1: 91,153,328 T413A probably benign Het
Rnf135 T C 11: 80,198,836 C333R probably damaging Het
Scfd2 A G 5: 74,519,565 V309A probably damaging Het
Serpina3m A T 12: 104,389,649 K192* probably null Het
Sh3tc2 A G 18: 61,990,435 I756V probably benign Het
Slc27a4 T C 2: 29,812,636 V516A probably damaging Het
Sult2a5 T A 7: 13,625,263 C55S probably benign Het
Tarsl2 C T 7: 65,691,294 T783M probably benign Het
Tet2 A T 3: 133,467,044 I1819N possibly damaging Het
Timeless T C 10: 128,250,762 F1057L probably damaging Het
Ttn T A 2: 76,798,074 I12835F probably damaging Het
Uhrf1 T A 17: 56,310,834 D185E probably benign Het
Vmn2r74 G T 7: 85,955,991 S483* probably null Het
Xpo1 A T 11: 23,281,327 I304F possibly damaging Het
Zc3h11a A G 1: 133,624,711 S553P probably benign Het
Zdhhc1 A G 8: 105,472,852 S402P probably benign Het
Zwilch T C 9: 64,162,746 Y101C probably damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- ACTGTCATGGTTTGTGATGCCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On2017-04-14