Incidental Mutation 'R4875:Gcn1l1'
ID472539
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R4875 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115576170 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 123 (L123P)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064454
AA Change: L123P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: L123P

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184777
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cpne8 T A 15: 90,648,568 probably benign Het
Ctso C T 3: 81,942,381 probably benign Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Helz T A 11: 107,637,734 probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mgat5 G A 1: 127,469,249 V578M probably damaging Het
Mis18bp1 G A 12: 65,161,435 T168M probably benign Het
Mospd4 G T 18: 46,465,737 noncoding transcript Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncam1 T C 9: 49,507,621 probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Ndufv1 T C 19: 4,012,653 probably null Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Plpp2 G A 10: 79,530,929 T51M probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Scn1a T C 2: 66,328,476 T367A possibly damaging Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Sp9 T C 2: 73,273,618 V172A possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Strap ACCTGCCCTCCT ACCT 6: 137,749,318 probably benign Het
Synj2 A T 17: 5,988,068 probably benign Het
Tgif2-ps2 A G 17: 40,115,383 noncoding transcript Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Tpx2 C A 2: 152,893,615 A721E probably benign Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tuba8 T A 6: 121,226,083 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
Predicted Primers
Posted On2017-04-14