Incidental Mutation 'R4875:Ncam1'
ID472546
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R4875 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 49507621 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166811] [ENSMUST00000193547]
Predicted Effect probably benign
Transcript: ENSMUST00000166811
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193547
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194252
AA Change: D793G
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cpne8 T A 15: 90,648,568 probably benign Het
Ctso C T 3: 81,942,381 probably benign Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gcn1l1 T C 5: 115,576,170 L123P possibly damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Helz T A 11: 107,637,734 probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mgat5 G A 1: 127,469,249 V578M probably damaging Het
Mis18bp1 G A 12: 65,161,435 T168M probably benign Het
Mospd4 G T 18: 46,465,737 noncoding transcript Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Ndufv1 T C 19: 4,012,653 probably null Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Plpp2 G A 10: 79,530,929 T51M probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Scn1a T C 2: 66,328,476 T367A possibly damaging Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Sp9 T C 2: 73,273,618 V172A possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Strap ACCTGCCCTCCT ACCT 6: 137,749,318 probably benign Het
Synj2 A T 17: 5,988,068 probably benign Het
Tgif2-ps2 A G 17: 40,115,383 noncoding transcript Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Tpx2 C A 2: 152,893,615 A721E probably benign Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tuba8 T A 6: 121,226,083 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1398:Ncam1 UTSW 9 49517589 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1676:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R1951:Ncam1 UTSW 9 49545192 missense probably benign 0.36
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2290:Ncam1 UTSW 9 49523651 splice site probably benign
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R3002:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4289:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5512:Ncam1 UTSW 9 49509699 splice site probably null
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6060:Ncam1 UTSW 9 49531959 intron probably benign
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6392:Ncam1 UTSW 9 49523575 missense probably damaging 0.99
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers
Posted On2017-04-14