Incidental Mutation 'R4875:Mis18bp1'
ID472555
Institutional Source Beutler Lab
Gene Symbol Mis18bp1
Ensembl Gene ENSMUSG00000047534
Gene NameMIS18 binding protein 1
SynonymsC79407
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R4875 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location65132734-65172604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65161435 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 168 (T168M)
Ref Sequence ENSEMBL: ENSMUSP00000152490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052201] [ENSMUST00000124201] [ENSMUST00000221296] [ENSMUST00000222244]
Predicted Effect probably benign
Transcript: ENSMUST00000052201
AA Change: T168M

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052109
Gene: ENSMUSG00000047534
AA Change: T168M

DomainStartEndE-ValueType
low complexity region 319 332 N/A INTRINSIC
Pfam:SANTA 336 425 1.4e-27 PFAM
coiled coil region 428 448 N/A INTRINSIC
coiled coil region 645 668 N/A INTRINSIC
SANT 742 794 9.48e-6 SMART
low complexity region 874 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140391
Predicted Effect probably benign
Transcript: ENSMUST00000221296
Predicted Effect probably benign
Transcript: ENSMUST00000222244
AA Change: T168M

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cpne8 T A 15: 90,648,568 probably benign Het
Ctso C T 3: 81,942,381 probably benign Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gcn1l1 T C 5: 115,576,170 L123P possibly damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Helz T A 11: 107,637,734 probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mgat5 G A 1: 127,469,249 V578M probably damaging Het
Mospd4 G T 18: 46,465,737 noncoding transcript Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncam1 T C 9: 49,507,621 probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Ndufv1 T C 19: 4,012,653 probably null Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Plpp2 G A 10: 79,530,929 T51M probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Scn1a T C 2: 66,328,476 T367A possibly damaging Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Sp9 T C 2: 73,273,618 V172A possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Strap ACCTGCCCTCCT ACCT 6: 137,749,318 probably benign Het
Synj2 A T 17: 5,988,068 probably benign Het
Tgif2-ps2 A G 17: 40,115,383 noncoding transcript Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Tpx2 C A 2: 152,893,615 A721E probably benign Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tuba8 T A 6: 121,226,083 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Other mutations in Mis18bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Mis18bp1 APN 12 65158441 missense possibly damaging 0.68
IGL01383:Mis18bp1 APN 12 65148989 missense probably benign 0.05
IGL01736:Mis18bp1 APN 12 65138678 missense probably damaging 1.00
IGL02037:Mis18bp1 APN 12 65136748 critical splice donor site probably null
IGL02210:Mis18bp1 APN 12 65136831 nonsense probably null
IGL02318:Mis18bp1 APN 12 65158741 missense probably benign 0.04
IGL02541:Mis18bp1 APN 12 65161460 missense probably damaging 0.97
IGL02664:Mis18bp1 APN 12 65153880 nonsense probably null
IGL02838:Mis18bp1 APN 12 65136826 missense probably damaging 0.99
IGL03031:Mis18bp1 APN 12 65161930 missense probably benign
R0555:Mis18bp1 UTSW 12 65161453 missense possibly damaging 0.94
R1169:Mis18bp1 UTSW 12 65143283 nonsense probably null
R1517:Mis18bp1 UTSW 12 65133813 missense probably benign 0.03
R1702:Mis18bp1 UTSW 12 65161744 missense probably benign
R1705:Mis18bp1 UTSW 12 65149339 missense probably benign 0.19
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1973:Mis18bp1 UTSW 12 65149076 nonsense probably null
R1990:Mis18bp1 UTSW 12 65158694 missense probably benign 0.03
R2023:Mis18bp1 UTSW 12 65149109 missense probably damaging 0.97
R2043:Mis18bp1 UTSW 12 65149418 missense probably damaging 1.00
R2318:Mis18bp1 UTSW 12 65140843 missense possibly damaging 0.92
R2897:Mis18bp1 UTSW 12 65133586 missense probably benign 0.09
R3120:Mis18bp1 UTSW 12 65156988 splice site probably null
R3845:Mis18bp1 UTSW 12 65149142 missense possibly damaging 0.61
R4578:Mis18bp1 UTSW 12 65153881 missense probably damaging 1.00
R4590:Mis18bp1 UTSW 12 65158506 missense possibly damaging 0.50
R4614:Mis18bp1 UTSW 12 65153529 intron probably benign
R4626:Mis18bp1 UTSW 12 65140766 missense probably damaging 1.00
R4724:Mis18bp1 UTSW 12 65158739 missense probably benign 0.18
R4873:Mis18bp1 UTSW 12 65161435 missense probably benign 0.23
R5173:Mis18bp1 UTSW 12 65149375 missense possibly damaging 0.96
R5294:Mis18bp1 UTSW 12 65157043 missense probably damaging 1.00
R5540:Mis18bp1 UTSW 12 65148746 missense possibly damaging 0.83
R5560:Mis18bp1 UTSW 12 65152816 missense possibly damaging 0.83
R5584:Mis18bp1 UTSW 12 65154776 missense probably damaging 0.98
R5661:Mis18bp1 UTSW 12 65148852 missense probably benign 0.41
R6235:Mis18bp1 UTSW 12 65158408 missense probably damaging 0.99
R6282:Mis18bp1 UTSW 12 65149163 missense probably benign 0.01
R6284:Mis18bp1 UTSW 12 65138787 missense probably benign 0.32
R6378:Mis18bp1 UTSW 12 65149247 missense probably benign 0.11
R6418:Mis18bp1 UTSW 12 65158543 missense possibly damaging 0.64
X0058:Mis18bp1 UTSW 12 65149226 missense probably damaging 0.99
Predicted Primers
Posted On2017-04-14