Incidental Mutation 'R4873:Plpp2'
ID472593
Institutional Source Beutler Lab
Gene Symbol Plpp2
Ensembl Gene ENSMUSG00000052151
Gene Namephospholipid phosphatase 2
SynonymsLpp2, Ppap2c
MMRRC Submission 042483-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4873 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79526430-79533796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79530929 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 51 (T51M)
Ref Sequence ENSEMBL: ENSMUSP00000069670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063879] [ENSMUST00000165233] [ENSMUST00000166804] [ENSMUST00000218241]
Predicted Effect probably damaging
Transcript: ENSMUST00000063879
AA Change: T51M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069670
Gene: ENSMUSG00000052151
AA Change: T51M

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
Blast:acidPPc 21 70 6e-9 BLAST
acidPPc 99 239 1.42e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163602
Predicted Effect probably benign
Transcript: ENSMUST00000165233
SMART Domains Protein: ENSMUSP00000127000
Gene: ENSMUSG00000052151

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166804
SMART Domains Protein: ENSMUSP00000133247
Gene: ENSMUSG00000052151

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
acidPPc 43 183 1.42e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184212
Predicted Effect probably benign
Transcript: ENSMUST00000218241
Meta Mutation Damage Score 0.0364 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: The protein encoded by this gene is a lipid phosphate phosphohydrolase. It is an integral membrane protein that catalyzes the conversion of phosphatidic acid to diacylglycerol and inorganic phosphate. The transcript is expressed at high levels in lung, liver, and kidney and at low levels in brain and heart. Null mutant mice are viable and fertile and display no overt phenotypic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gcn1l1 T C 5: 115,576,170 L123P possibly damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mgat5 G A 1: 127,469,249 V578M probably damaging Het
Mis18bp1 G A 12: 65,161,435 T168M probably benign Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncam1 T C 9: 49,507,621 probably benign Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Oscar A T 7: 3,616,017 probably null Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Scn1a T C 2: 66,328,476 T367A possibly damaging Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Sp9 T C 2: 73,273,618 V172A possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Synj2 A T 17: 5,988,068 probably benign Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Tpx2 C A 2: 152,893,615 A721E probably benign Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tubgcp4 T A 2: 121,184,849 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Plpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Plpp2 APN 10 79527493 missense probably damaging 1.00
IGL03327:Plpp2 APN 10 79530984 splice site probably null
Trust UTSW 10 79530929 missense probably damaging 1.00
R0009:Plpp2 UTSW 10 79527244 missense probably benign 0.01
R0056:Plpp2 UTSW 10 79527229 missense probably damaging 0.99
R0097:Plpp2 UTSW 10 79530537 missense possibly damaging 0.50
R0311:Plpp2 UTSW 10 79527580 missense probably damaging 0.97
R0840:Plpp2 UTSW 10 79527544 missense probably benign 0.16
R1406:Plpp2 UTSW 10 79530777 splice site probably benign
R1642:Plpp2 UTSW 10 79530684 missense probably damaging 1.00
R3436:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R3437:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R4400:Plpp2 UTSW 10 79527493 missense possibly damaging 0.88
R4521:Plpp2 UTSW 10 79530625 missense probably damaging 1.00
R4875:Plpp2 UTSW 10 79530929 missense probably damaging 1.00
R5114:Plpp2 UTSW 10 79527139 missense probably benign 0.41
R6970:Plpp2 UTSW 10 79530546 missense possibly damaging 0.90
R7383:Plpp2 UTSW 10 79531007 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- ACGGTCTGTGTACACCAGGTAGG -3'
(R):5'- CTGCTGAGTAGTTGGGCTCATTC -3'

Sequencing Primer
(F):5'- AGGCTTCTCCCAATGAGACC -3'
(R):5'- CAAAGAAGCCAATGGAGTAG -3'
Posted On2017-04-14