Incidental Mutation 'R4839:Mfrp'
ID472644
Institutional Source Beutler Lab
Gene Symbol Mfrp
Ensembl Gene ENSMUSG00000034739
Gene Namemembrane frizzled-related protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4839 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44101729-44109187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44102135 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 52 (H52Q)
Ref Sequence ENSEMBL: ENSMUSP00000125053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034654] [ENSMUST00000065379] [ENSMUST00000161381] [ENSMUST00000161703] [ENSMUST00000162126] [ENSMUST00000185479] [ENSMUST00000205282] [ENSMUST00000206308]
Predicted Effect probably benign
Transcript: ENSMUST00000034654
AA Change: H52Q

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034654
Gene: ENSMUSG00000034739
AA Change: H52Q

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 471 577 3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065379
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161381
AA Change: H52Q

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124456
Gene: ENSMUSG00000034739
AA Change: H52Q

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 465 576 9.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161703
AA Change: H52Q

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125053
Gene: ENSMUSG00000034739
AA Change: H52Q

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
LDLa 307 342 2.09e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162196
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205282
Predicted Effect probably benign
Transcript: ENSMUST00000206308
AA Change: H52Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000206722
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains a region with similarity to the cysteine-rich domain (CRD) of frizzled, a gene originally found in Drosophila that controls tissue polarity. This protein functions in eye development, where it is necessary for the maintenance of photoreceptor outer segments. Mutations in this gene cause retinal degeneration 6 in mice, which gives rise to a mouse model for human retinitis punctata albescens. Bicistronic transcripts composed of the coding sequences for this gene (Mfrp) and the C1q and tumor necrosis factor related protein 5 gene (C1qtnf5) have been identified, and the resulting products can interact with each other. Co-transcription of C1qtnf5 and Mfrp has been observed in both human and mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mutations produce mice having small, white retinal spots and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,013 S467T probably benign Het
2310030G06Rik A T 9: 50,740,723 Y68* probably null Het
4931408C20Rik T C 1: 26,685,359 T247A probably benign Het
9130019O22Rik T C 7: 127,385,007 S308G probably benign Het
Abat T G 16: 8,583,648 probably benign Het
Abca2 C T 2: 25,440,909 S1203F probably damaging Het
Adam22 G A 5: 8,136,813 P436L probably damaging Het
Ak3 A C 19: 29,047,732 L33R probably damaging Het
Arhgap11a A T 2: 113,842,029 I198K probably damaging Het
Arl14epl A T 18: 46,932,477 K103M possibly damaging Het
Atg16l1 T A 1: 87,766,174 N65K probably damaging Het
Btnl2 G A 17: 34,365,286 W394* probably null Het
Cacna1e C A 1: 154,421,058 R1687L probably damaging Het
Cacna1g G T 11: 94,459,607 R471S probably benign Het
Cdh13 A T 8: 118,851,848 R205* probably null Het
Cdkl3 A T 11: 52,005,034 Y36F probably damaging Het
Cep290 T A 10: 100,508,786 N488K probably damaging Het
Cep350 A T 1: 155,928,494 C948S probably benign Het
Cep70 A G 9: 99,296,085 K446R probably benign Het
Cfap70 T C 14: 20,425,529 T375A probably damaging Het
Cfhr1 A G 1: 139,560,133 L9S probably damaging Het
Chrm4 T A 2: 91,927,607 M120K probably damaging Het
Col1a1 A G 11: 94,950,095 probably null Het
Col3a1 T C 1: 45,323,803 probably null Het
Csrnp3 A T 2: 66,022,031 R256* probably null Het
Dbf4 T A 5: 8,408,263 K190* probably null Het
Dnah10 A T 5: 124,773,132 I1573F probably damaging Het
Dock8 A G 19: 25,169,494 I1446V probably benign Het
Dst G T 1: 34,190,862 R2187M probably damaging Het
Ece2 C T 16: 20,631,168 R257C probably damaging Het
Espn A G 4: 152,138,504 Y306H probably damaging Het
Fam208b G A 13: 3,584,807 P667S probably damaging Het
Fkbpl G A 17: 34,645,865 M202I probably benign Het
Fn1 A G 1: 71,642,083 L362P probably damaging Het
Ganc A C 2: 120,459,823 R880S probably benign Het
Gucy1b2 A T 14: 62,448,246 L90Q probably damaging Het
Hcn1 T A 13: 117,925,710 I504N unknown Het
Hdac2 C A 10: 36,997,466 T352K probably benign Het
Hip1 T C 5: 135,426,318 probably null Het
Hspa13 G A 16: 75,765,281 S10L probably damaging Het
Ipo5 T C 14: 120,920,038 I96T probably benign Het
Isl1 T C 13: 116,301,684 Y264C probably damaging Het
Izumo1 T C 7: 45,626,233 I322T probably benign Het
Kars A C 8: 112,002,526 V183G possibly damaging Het
Lrrc15 C A 16: 30,274,268 M84I probably benign Het
Magi1 A T 6: 93,694,196 V796E probably damaging Het
Matn4 G T 2: 164,400,976 D67E probably benign Het
Mertk A G 2: 128,782,576 M636V probably damaging Het
Mettl27 C A 5: 134,934,412 P126T probably damaging Het
Mrgprb8 T G 7: 48,388,908 I109R probably benign Het
Mroh2a G A 1: 88,237,944 G512S probably damaging Het
Ncoa7 T A 10: 30,722,659 R89S possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nin G T 12: 70,090,551 H84N possibly damaging Het
Nwd2 A T 5: 63,805,550 I826F possibly damaging Het
Olfr195 A G 16: 59,149,030 Y60C probably damaging Het
Olfr299 T C 7: 86,465,909 F166S probably damaging Het
Olfr339 G A 2: 36,422,000 V201I probably benign Het
Olfr498 T C 7: 108,465,731 S136P probably benign Het
Olfr69 T C 7: 103,767,754 I214M possibly damaging Het
Olfr724 C T 14: 49,960,189 M294I probably benign Het
Olfr959 A G 9: 39,573,145 M38T probably benign Het
Otof C T 5: 30,419,404 R168H probably damaging Het
Pcdha6 T C 18: 36,968,432 V226A possibly damaging Het
Pggt1b T C 18: 46,258,099 I200V possibly damaging Het
Ppat G A 5: 76,950,964 Q41* probably null Het
Ppfibp2 A T 7: 107,742,985 H27L probably damaging Het
Rbm27 T A 18: 42,327,445 I775N probably damaging Het
Rnf40 C T 7: 127,592,640 R349* probably null Het
Rtp3 A T 9: 110,989,476 W46R probably damaging Het
Sass6 C T 3: 116,610,300 R196W probably damaging Het
Sel1l A T 12: 91,833,158 D131E probably benign Het
Slain2 T C 5: 72,948,723 S234P probably damaging Het
Slc47a1 C T 11: 61,373,350 probably null Het
Sp140 CAGAAGAAG CAGAAG 1: 85,610,808 probably benign Het
Spef2 A T 15: 9,713,178 Y369* probably null Het
Spred2 T A 11: 19,998,233 M76K possibly damaging Het
Svs2 T A 2: 164,236,886 D367V probably benign Het
Tefm A T 11: 80,137,121 D270E probably benign Het
Tfcp2l1 C A 1: 118,669,464 P425H probably benign Het
Thbd A T 2: 148,406,671 C426S probably damaging Het
Timm10b T A 7: 105,684,012 D968E probably damaging Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Tnik T A 3: 28,596,075 Y446N possibly damaging Het
Tpr T A 1: 150,449,197 L2400* probably null Het
Trrap T C 5: 144,845,592 F3328S probably damaging Het
Vldlr G A 19: 27,238,065 C154Y probably damaging Het
Vmn1r79 T G 7: 12,176,434 M81R probably benign Het
Vps13d T C 4: 145,085,430 T3305A possibly damaging Het
Wdr62 T A 7: 30,241,465 I843F probably benign Het
Wdr62 T C 7: 30,270,686 E232G probably damaging Het
Zfp873 T A 10: 82,060,519 H361Q probably damaging Het
Zfp949 A C 9: 88,569,994 H539P probably damaging Het
Other mutations in Mfrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Mfrp APN 9 44104689 missense probably benign 0.39
IGL02077:Mfrp APN 9 44105220 missense probably damaging 1.00
IGL02313:Mfrp APN 9 44102874 missense probably damaging 1.00
IGL02544:Mfrp APN 9 44102794 missense probably damaging 1.00
IGL02709:Mfrp APN 9 44103264 missense probably benign 0.00
R1592:Mfrp UTSW 9 44103222 missense probably damaging 1.00
R1728:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1729:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1886:Mfrp UTSW 9 44103488 missense possibly damaging 0.94
R1974:Mfrp UTSW 9 44106372 missense probably damaging 1.00
R2146:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2150:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2512:Mfrp UTSW 9 44102538 missense probably benign 0.01
R3788:Mfrp UTSW 9 44105457 nonsense probably null
R4204:Mfrp UTSW 9 44105228 missense possibly damaging 0.86
R4240:Mfrp UTSW 9 44102866 missense possibly damaging 0.91
R4963:Mfrp UTSW 9 44103264 missense probably benign 0.33
R5041:Mfrp UTSW 9 44102278 missense probably damaging 1.00
R6370:Mfrp UTSW 9 44106261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGAAGGACTATGACGACG -3'
(R):5'- AGGATGACAGCCACCAGTAG -3'

Sequencing Primer
(F):5'- ACGTCATCCTCCGTCCAGAG -3'
(R):5'- AGTAGCCCCAGCAGCAG -3'
Posted On2017-04-14