Incidental Mutation 'R0503:Rfx4'
ID47267
Institutional Source Beutler Lab
Gene Symbol Rfx4
Ensembl Gene ENSMUSG00000020037
Gene Nameregulatory factor X, 4 (influences HLA class II expression)
Synonyms4933412G19Rik
MMRRC Submission 038698-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location84756062-84906538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84894332 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 495 (I495K)
Ref Sequence ENSEMBL: ENSMUSP00000093035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060397] [ENSMUST00000095388] [ENSMUST00000166696]
Predicted Effect probably benign
Transcript: ENSMUST00000060397
AA Change: I589K

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051107
Gene: ENSMUSG00000020037
AA Change: I589K

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 58 136 7.9e-37 PFAM
Blast:HisKA 293 356 5e-7 BLAST
low complexity region 503 515 N/A INTRINSIC
low complexity region 521 537 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095388
AA Change: I495K

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093035
Gene: ENSMUSG00000020037
AA Change: I495K

DomainStartEndE-ValueType
SCOP:d1kwha_ 11 201 6e-3 SMART
Blast:HisKA 199 262 4e-7 BLAST
low complexity region 409 421 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166696
AA Change: I446K

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128690
Gene: ENSMUSG00000020037
AA Change: I446K

DomainStartEndE-ValueType
Blast:HisKA 150 213 6e-7 BLAST
low complexity region 360 372 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Inactivating null allele or homozygous point mutation alleles exhibit missing dorsal midline structure of the cortex including the subcommissural organ and neonatal lethality. Heterozygous null mice have congenital hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Rfx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Rfx4 APN 10 84840199 missense probably damaging 1.00
IGL00334:Rfx4 APN 10 84780053 missense possibly damaging 0.91
IGL00928:Rfx4 APN 10 84840114 missense probably benign 0.04
IGL01063:Rfx4 APN 10 84868382 missense possibly damaging 0.90
IGL01490:Rfx4 APN 10 84840851 missense possibly damaging 0.85
IGL02390:Rfx4 APN 10 84840150 missense probably damaging 1.00
IGL02454:Rfx4 APN 10 84840106 missense possibly damaging 0.83
R0099:Rfx4 UTSW 10 84894304 missense probably benign
R0924:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R0930:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R1386:Rfx4 UTSW 10 84863285 missense probably damaging 1.00
R1715:Rfx4 UTSW 10 84844280 missense probably damaging 1.00
R1738:Rfx4 UTSW 10 84880975 critical splice donor site probably null
R1987:Rfx4 UTSW 10 84896088 missense possibly damaging 0.87
R3717:Rfx4 UTSW 10 84880224 missense probably damaging 1.00
R4231:Rfx4 UTSW 10 84814694 missense probably benign 0.03
R4300:Rfx4 UTSW 10 84905102 missense probably damaging 0.98
R4581:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4582:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4618:Rfx4 UTSW 10 84880896 missense probably benign 0.01
R5156:Rfx4 UTSW 10 84868354 missense probably damaging 1.00
R5185:Rfx4 UTSW 10 84863250 missense probably damaging 1.00
R5377:Rfx4 UTSW 10 84860542 missense possibly damaging 0.81
R5601:Rfx4 UTSW 10 84798578 missense probably damaging 1.00
R5879:Rfx4 UTSW 10 84814761 critical splice donor site probably null
R5996:Rfx4 UTSW 10 84840017 nonsense probably null
R6358:Rfx4 UTSW 10 84844235 missense probably damaging 1.00
R6805:Rfx4 UTSW 10 84840228 missense possibly damaging 0.86
R7248:Rfx4 UTSW 10 84905055 missense probably benign 0.05
X0024:Rfx4 UTSW 10 84780074 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTGTGCTGCCAGAGATTGTGATACC -3'
(R):5'- AGCTACAGGCCATTCAGCCTTTC -3'

Sequencing Primer
(F):5'- GATTCTATGACTCTACCAGGAGCTG -3'
(R):5'- GCCATTCAGCCTTTCTTCCATC -3'
Posted On2013-06-12