Incidental Mutation 'R4788:Ckmt1'
ID472953
Institutional Source Beutler Lab
Gene Symbol Ckmt1
Ensembl Gene ENSMUSG00000000308
Gene Namecreatine kinase, mitochondrial 1, ubiquitous
Synonymsmi-CK, UbCKmit, Mt-CK
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121357714-121363737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121359946 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 118 (V118A)
Ref Sequence ENSEMBL: ENSMUSP00000115501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000110625] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000125221] [ENSMUST00000125812] [ENSMUST00000126130] [ENSMUST00000128612] [ENSMUST00000129130] [ENSMUST00000134796] [ENSMUST00000150271]
Predicted Effect probably benign
Transcript: ENSMUST00000000317
AA Change: V118A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308
AA Change: V118A

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 58 133 5.8e-34 PFAM
Pfam:ATP-gua_Ptrans 154 401 4.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038389
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078222
AA Change: V118A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308
AA Change: V118A

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 1.2e-37 PFAM
Pfam:ATP-gua_Ptrans 154 401 2e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110625
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110627
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110628
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125221
SMART Domains Protein: ENSMUSP00000121930
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 117 5.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125812
AA Change: V118A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115501
Gene: ENSMUSG00000000308
AA Change: V118A

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 9.7e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000126130
AA Change: Y52H
SMART Domains Protein: ENSMUSP00000117463
Gene: ENSMUSG00000000308
AA Change: Y52H

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128612
SMART Domains Protein: ENSMUSP00000115610
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129130
AA Change: V149A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123130
Gene: ENSMUSG00000000308
AA Change: V149A

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 86 165 5.7e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134644
Predicted Effect probably benign
Transcript: ENSMUST00000134796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150081
Predicted Effect possibly damaging
Transcript: ENSMUST00000150271
AA Change: V118A

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120507
Gene: ENSMUSG00000000308
AA Change: V118A

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 3.3e-38 PFAM
Pfam:ATP-gua_Ptrans 154 251 3.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153040
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele have no visual or motor impairments but display diminished open field habituation and slower spatial learning acquisition in the Morris water maze task as well as a reduced acoustic startle response, higher threshold, and lack of prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Ckmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Ckmt1 APN 2 121361150 missense probably damaging 1.00
IGL01141:Ckmt1 APN 2 121362993 missense probably benign 0.07
IGL01403:Ckmt1 APN 2 121362966 unclassified probably benign
IGL01971:Ckmt1 APN 2 121363583 missense probably benign 0.41
IGL02037:Ckmt1 APN 2 121361162 missense probably damaging 0.99
IGL02750:Ckmt1 APN 2 121363615 unclassified probably benign
IGL03303:Ckmt1 APN 2 121360005 missense probably benign
R0157:Ckmt1 UTSW 2 121363041 missense possibly damaging 0.86
R0331:Ckmt1 UTSW 2 121362856 unclassified probably null
R1590:Ckmt1 UTSW 2 121363522 missense possibly damaging 0.96
R1640:Ckmt1 UTSW 2 121359717 unclassified probably null
R1853:Ckmt1 UTSW 2 121360650 missense probably damaging 1.00
R4726:Ckmt1 UTSW 2 121361231 critical splice donor site probably null
R5632:Ckmt1 UTSW 2 121360592 missense probably damaging 1.00
R5633:Ckmt1 UTSW 2 121363629 unclassified probably benign
R5960:Ckmt1 UTSW 2 121363577 missense probably damaging 1.00
R6123:Ckmt1 UTSW 2 121363579 missense probably benign 0.05
R6673:Ckmt1 UTSW 2 121359670 missense probably damaging 1.00
X0067:Ckmt1 UTSW 2 121360967 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAAGACTGTGGGCATGGTG -3'
(R):5'- GCAGTCTAACCCTGAGTCAG -3'

Sequencing Primer
(F):5'- GCTGGAGATGAGGAGACCTATG -3'
(R):5'- TCAGGAAACAAGGTGTAATGATTG -3'
Posted On2017-04-14