Incidental Mutation 'R3772:Cxcl17'
ID473709
Institutional Source Beutler Lab
Gene Symbol Cxcl17
Ensembl Gene ENSMUSG00000060188
Gene Namechemokine (C-X-C motif) ligand 17
Synonyms
MMRRC Submission 040748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.021) question?
Stock #R3772 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25400053-25412886 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 25400329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003207] [ENSMUST00000074040] [ENSMUST00000105177] [ENSMUST00000149349] [ENSMUST00000200880]
Predicted Effect probably benign
Transcript: ENSMUST00000003207
SMART Domains Protein: ENSMUSP00000003207
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
Pfam:HSL_N 44 358 4.6e-148 PFAM
Pfam:DUF2424 345 504 1.1e-8 PFAM
Pfam:Abhydrolase_3 388 548 3e-36 PFAM
low complexity region 611 626 N/A INTRINSIC
Pfam:Abhydrolase_3 684 771 6.4e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000074040
AA Change: S127P
SMART Domains Protein: ENSMUSP00000073687
Gene: ENSMUSG00000060188
AA Change: S127P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 126 2.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105177
SMART Domains Protein: ENSMUSP00000100811
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149349
SMART Domains Protein: ENSMUSP00000123485
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Pfam:HSL_N 319 627 1.2e-116 PFAM
Pfam:DUF2424 616 774 1.2e-8 PFAM
Pfam:Abhydrolase_3 658 817 1.9e-34 PFAM
low complexity region 881 896 N/A INTRINSIC
Pfam:Abhydrolase_3 951 1041 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200880
SMART Domains Protein: ENSMUSP00000144096
Gene: ENSMUSG00000060188

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 111 2.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206436
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mucosal chemokine that attracts immature dendritic cells and blood monocytes to the lungs. The encoded protein also promotes tumorigenesis through an angiogenic activity. Finally, this protein exhibits strong antimicrobial activity against E. coli, S. aureus, Salmonella, P. aeruginosa, and C. albicans. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adgrl1 A G 8: 83,923,004 N97S possibly damaging Het
Aldh1a2 A G 9: 71,252,920 D76G probably damaging Het
Aldh3a1 A G 11: 61,214,605 E179G possibly damaging Het
Ap1g1 A G 8: 109,837,786 D324G probably damaging Het
Arfgap2 A G 2: 91,265,366 T12A probably benign Het
Aurka A G 2: 172,366,960 L85P probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Bmp7 A T 2: 172,870,222 I403N probably damaging Het
Carns1 A G 19: 4,170,916 probably benign Het
Ccdc88c G A 12: 100,966,100 probably benign Het
Ccl2 C T 11: 82,036,958 A76V probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Col24a1 T C 3: 145,545,286 L1680P probably damaging Het
Col4a6 C A X: 141,172,200 G1416C probably damaging Het
Ctnna2 T G 6: 76,973,769 N573T probably damaging Het
Cts8 G A 13: 61,250,901 probably benign Het
Defb18 T C 1: 18,236,621 H37R possibly damaging Het
Dis3l2 T C 1: 86,854,408 I229T probably benign Het
Dysf G A 6: 84,152,351 S1474N possibly damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
F13a1 T C 13: 36,898,134 K532R probably benign Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Focad A C 4: 88,336,161 probably benign Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Frrs1 T G 3: 116,878,387 S45A possibly damaging Het
Gm5422 T A 10: 31,248,514 noncoding transcript Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Iglon5 A T 7: 43,480,613 Y42* probably null Het
Khdrbs2 C T 1: 32,244,076 Q90* probably null Het
Krt74 T C 15: 101,762,195 noncoding transcript Het
Lamc2 T A 1: 153,124,251 M1121L probably benign Het
Lrig1 A G 6: 94,605,817 L1073P probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Megf10 G A 18: 57,283,862 D768N probably benign Het
Mycbp2 T C 14: 103,133,788 N4108S possibly damaging Het
Nid1 A G 13: 13,476,418 probably benign Het
Nnt A G 13: 119,396,952 V59A probably damaging Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Pag1 G A 3: 9,699,628 T155M probably benign Het
Pgam5 T C 5: 110,265,593 H176R probably damaging Het
Pid1 T C 1: 84,038,197 D149G probably damaging Het
Pkp3 G A 7: 141,082,346 M1I probably null Het
Pld2 C T 11: 70,544,123 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rab9b T A X: 136,861,449 E67D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf214 T C 9: 45,866,634 M625V possibly damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Sept10 A T 10: 59,176,887 M303K probably damaging Het
Sez6l2 A G 7: 126,959,203 E339G probably damaging Het
Sf3b1 C A 1: 54,999,991 probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
St18 A T 1: 6,844,329 K799I probably damaging Het
Strada C T 11: 106,164,822 R333Q probably damaging Het
Stradb A T 1: 58,985,385 I64L probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tnk2 A G 16: 32,679,822 D651G probably damaging Het
Trim43c A T 9: 88,847,757 D417V probably damaging Het
Tsc22d4 T C 5: 137,759,233 L374P possibly damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ubr4 T C 4: 139,452,700 V262A possibly damaging Het
Vmn2r60 A T 7: 42,116,556 N29I probably benign Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 C T 15: 88,780,787 P353S probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zwilch A T 9: 64,156,034 F286I probably benign Het
Other mutations in Cxcl17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1527:Cxcl17 UTSW 7 25402211 missense possibly damaging 0.51
R5913:Cxcl17 UTSW 7 25402246 nonsense probably null
R7227:Cxcl17 UTSW 7 25402894 missense probably damaging 0.96
Predicted Primers
Posted On2017-04-14