Incidental Mutation 'R0504:Arid4a'
ID47379
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene NameAT rich interactive domain 4A (RBP1-like)
SynonymsRbbp1, A630067N03Rik
MMRRC Submission 038699-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0504 (G1)
Quality Score224
Status Validated
Chromosome12
Chromosomal Location71015990-71098592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71047214 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 254 (F254I)
Ref Sequence ENSEMBL: ENSMUSP00000121109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000125125] [ENSMUST00000135709]
Predicted Effect probably damaging
Transcript: ENSMUST00000046305
AA Change: F254I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: F254I

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125125
AA Change: F254I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121109
Gene: ENSMUSG00000048118
AA Change: F254I

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 5.53e-10 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 168 263 6e-49 PFAM
low complexity region 267 295 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134718
Predicted Effect probably benign
Transcript: ENSMUST00000135709
SMART Domains Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118

DomainStartEndE-ValueType
ARID 1 75 1.02e-16 SMART
BRIGHT 1 80 2.05e-23 SMART
low complexity region 89 100 N/A INTRINSIC
CHROMO 161 330 1.08e-3 SMART
low complexity region 368 385 N/A INTRINSIC
Meta Mutation Damage Score 0.488 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (145/147)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A G 4: 103,270,860 probably benign Het
4931440F15Rik T C 11: 29,824,990 I156V probably damaging Het
Adamts6 T C 13: 104,426,930 probably benign Het
Adamts9 T A 6: 92,912,645 Y316F probably damaging Het
Agl A T 3: 116,786,784 F374I probably damaging Het
Akr1c19 A G 13: 4,236,251 T83A possibly damaging Het
Ankrd36 T A 11: 5,629,274 S179R probably damaging Het
Appbp2 A G 11: 85,191,687 S573P probably benign Het
Asna1 A C 8: 85,018,607 V277G probably damaging Het
Bin3 T C 14: 70,123,887 probably null Het
Bmi1 T C 2: 18,684,072 probably null Het
Bmper G T 9: 23,406,687 C534F probably damaging Het
Bora T A 14: 99,061,623 C205* probably null Het
Btnl2 A G 17: 34,358,117 E82G probably benign Het
Ccdc8 A T 7: 16,996,014 D476V unknown Het
Ccr3 C A 9: 124,029,441 T271K possibly damaging Het
Cd276 A G 9: 58,540,678 L23P possibly damaging Het
Cd3e T C 9: 45,002,254 Q61R probably benign Het
Cep97 A G 16: 55,905,779 S582P probably benign Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Chst1 A G 2: 92,613,824 N214D probably benign Het
Chuk T C 19: 44,081,938 probably benign Het
Col12a1 G A 9: 79,681,468 H1122Y possibly damaging Het
Cpne6 A G 14: 55,514,602 K272R probably damaging Het
Cpsf2 T A 12: 101,990,003 L355Q probably damaging Het
Cyp2c29 T A 19: 39,309,780 D256E probably benign Het
Daglb G A 5: 143,494,197 V420I probably benign Het
Ddx42 G T 11: 106,247,849 G825C probably benign Het
Dis3 T C 14: 99,081,390 probably benign Het
Dkk4 C T 8: 22,625,343 R70C probably damaging Het
Dock6 G T 9: 21,802,436 Q1933K probably damaging Het
Dpep2 T G 8: 105,989,988 Q186H probably benign Het
Dzip3 A C 16: 48,959,643 probably benign Het
Egflam T A 15: 7,222,758 I853F probably damaging Het
Fastkd5 A G 2: 130,615,917 I251T probably benign Het
Fbn2 T A 18: 58,039,460 D2091V possibly damaging Het
Fer1l4 C A 2: 156,052,195 V63L probably benign Het
Frem1 T A 4: 82,912,637 D2062V probably benign Het
Galnt6 A C 15: 100,696,657 probably benign Het
Gm10972 A T 3: 94,643,133 probably benign Het
Gm4846 G A 1: 166,491,545 T208I probably benign Het
Gorab A G 1: 163,386,605 L252P probably damaging Het
Gtsf2 A G 15: 103,444,561 C63R probably damaging Het
Hal T C 10: 93,489,174 V15A probably damaging Het
Hmcn1 A T 1: 150,876,419 probably benign Het
Hormad2 A T 11: 4,408,833 H191Q possibly damaging Het
Hspa2 A T 12: 76,405,216 D228V probably damaging Het
Igfn1 A T 1: 135,968,529 M1433K probably benign Het
Il18 A G 9: 50,575,328 D19G probably damaging Het
Il1rl2 G A 1: 40,329,056 V129I probably benign Het
Inpp5b C A 4: 124,782,408 Y352* probably null Het
Insrr A T 3: 87,813,156 M1034L possibly damaging Het
Jmjd1c T C 10: 67,225,755 S1296P probably damaging Het
Kdm5b G T 1: 134,621,023 probably null Het
Krba1 C T 6: 48,416,254 T998I probably benign Het
L3mbtl4 A G 17: 68,777,912 N606S probably benign Het
Lonrf1 T A 8: 36,231,159 N395I possibly damaging Het
Lpp A G 16: 24,971,970 D393G probably damaging Het
Lrrc17 A G 5: 21,560,530 I3M probably benign Het
Lrrtm4 A T 6: 80,022,046 Q147L probably damaging Het
Map1a A G 2: 121,302,941 M1413V probably benign Het
Mapk8ip2 A G 15: 89,456,658 E102G possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mdn1 T C 4: 32,698,916 probably benign Het
Mfng A C 15: 78,757,314 H294Q probably benign Het
Mical2 T A 7: 112,271,317 N4K probably benign Het
Mov10l1 T A 15: 88,998,839 V384E probably damaging Het
Myo18b A G 5: 112,873,576 probably benign Het
Nlrp1b T G 11: 71,182,415 I201L probably damaging Het
Nos2 C T 11: 78,940,077 P249L probably damaging Het
Notch4 A G 17: 34,575,091 T681A probably damaging Het
Nr1i3 C T 1: 171,217,236 probably benign Het
Obscn A G 11: 59,008,507 probably null Het
Olfr1024 T A 2: 85,904,686 M123L possibly damaging Het
Olfr1230 C T 2: 89,296,739 C177Y probably damaging Het
Olfr1248 A T 2: 89,618,094 Y33N probably damaging Het
Olfr237-ps1 A T 6: 43,153,461 H52L probably benign Het
Olfr328 C A 11: 58,551,636 C201F probably damaging Het
Olfr452 C T 6: 42,790,596 R186* probably null Het
Olfr517 C T 7: 108,868,850 M101I possibly damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr705 T A 7: 106,714,701 probably benign Het
Olfr881 A G 9: 37,993,142 T217A probably benign Het
Onecut2 A T 18: 64,340,749 I124F possibly damaging Het
Otol1 G A 3: 70,027,604 G310R probably damaging Het
Oxct2b T A 4: 123,116,840 S184R possibly damaging Het
Oxct2b ACTG A 4: 123,116,912 probably benign Het
P2rx6 A G 16: 17,567,427 probably benign Het
Pde4a A G 9: 21,204,403 N411S probably damaging Het
Phkb A T 8: 86,056,524 D983V probably benign Het
Piezo2 G A 18: 63,024,451 T2396I probably damaging Het
Pik3ap1 T A 19: 41,287,490 D717V probably damaging Het
Plce1 T A 19: 38,778,021 probably benign Het
Plekhg1 A G 10: 3,937,853 I261V probably damaging Het
Ppfia4 T C 1: 134,324,113 H441R probably damaging Het
Prpf8 T A 11: 75,501,942 probably benign Het
Ptn T A 6: 36,741,453 probably benign Het
Ptpn13 A G 5: 103,501,496 Y255C possibly damaging Het
Ptpn4 A G 1: 119,765,915 Y126H probably damaging Het
Ptprc T C 1: 138,088,697 N505D probably damaging Het
Ptprs T A 17: 56,454,220 I116F possibly damaging Het
Rab1a T G 11: 20,223,169 V90G probably damaging Het
Rcor1 T C 12: 111,101,668 V267A probably benign Het
Reep4 A G 14: 70,547,238 probably null Het
Rere T A 4: 150,615,322 probably benign Het
Rin3 T A 12: 102,387,564 Y743* probably null Het
Rprm A G 2: 54,085,055 S84P probably damaging Het
Sdhaf2 C T 19: 10,517,019 E109K probably damaging Het
Sec31b G T 19: 44,534,786 Q24K probably damaging Het
Sema5a T C 15: 32,574,803 probably benign Het
Sh3pxd2a T C 19: 47,267,747 Y844C probably damaging Het
Shmt2 A C 10: 127,520,072 N134K probably damaging Het
Slc9a8 C T 2: 167,424,205 A34V probably benign Het
Spidr A C 16: 16,140,072 S64A possibly damaging Het
Stk10 A G 11: 32,617,882 T895A probably benign Het
Syne2 A T 12: 76,033,591 probably benign Het
Szt2 T C 4: 118,372,952 probably null Het
Tecpr1 A T 5: 144,214,081 V303D probably damaging Het
Tet3 A G 6: 83,373,794 Y1048H probably damaging Het
Tfb2m A G 1: 179,545,831 C101R probably damaging Het
Tg T C 15: 66,682,404 V556A probably damaging Het
Thbs4 A C 13: 92,767,184 I441M probably benign Het
Thsd7a A T 6: 12,379,594 Y944N probably damaging Het
Tm9sf3 C A 19: 41,247,892 probably benign Het
Tmem145 T C 7: 25,311,362 F359S probably damaging Het
Ttc21b C T 2: 66,222,798 probably benign Het
Ttn A G 2: 76,749,536 V23671A probably damaging Het
Txnl4b T C 8: 109,571,471 I78T probably benign Het
Ubr4 C A 4: 139,406,578 L762I probably damaging Het
Ubr4 T C 4: 139,480,838 probably null Het
Ugt1a8 C T 1: 88,088,357 P164L probably damaging Het
Unc13b T C 4: 43,263,559 S1594P probably damaging Het
Utrn A T 10: 12,402,895 F912I probably benign Het
Vat1l T C 8: 114,236,579 probably benign Het
Vmn1r50 T A 6: 90,107,881 S203T probably damaging Het
Vmn2r4 A T 3: 64,389,363 L667Q probably damaging Het
Vmn2r66 T G 7: 85,006,815 Q331P probably damaging Het
Wdsub1 A T 2: 59,878,325 V68D possibly damaging Het
Wnk2 C G 13: 49,085,394 A564P possibly damaging Het
Wnk2 T A 13: 49,085,396 K563M probably damaging Het
Zan T A 5: 137,470,318 H297L probably damaging Het
Zfp426 A T 9: 20,470,031 H539Q probably damaging Het
Zfp488 T A 14: 33,970,540 N222I probably damaging Het
Zfp536 T A 7: 37,568,818 H391L probably damaging Het
Zp1 T A 19: 10,916,207 N31I probably damaging Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71072593 missense probably damaging 1.00
IGL00546:Arid4a APN 12 71075671 missense probably benign
IGL00553:Arid4a APN 12 71075977 missense probably benign 0.04
IGL00708:Arid4a APN 12 71072728 missense probably benign 0.02
IGL00847:Arid4a APN 12 71075718 missense probably damaging 1.00
IGL01112:Arid4a APN 12 71072733 critical splice donor site probably null
IGL01456:Arid4a APN 12 71067262 missense probably benign 0.00
IGL01505:Arid4a APN 12 71037115 missense probably damaging 1.00
IGL01555:Arid4a APN 12 71061527 splice site probably benign
IGL01631:Arid4a APN 12 71022262 splice site probably benign
IGL02958:Arid4a APN 12 71097563 missense probably benign 0.01
IGL03087:Arid4a APN 12 71075245 missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71039966 missense probably damaging 1.00
IGL03234:Arid4a APN 12 71045060 missense probably benign 0.34
after_8 UTSW 12 71023498 critical splice acceptor site probably null
ariano UTSW 12 71069860 nonsense probably null
guava UTSW 12 71072632 missense probably damaging 0.99
limoncello UTSW 12 71067341 splice site probably null
under_8 UTSW 12 71063206 missense probably benign 0.10
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0270:Arid4a UTSW 12 71072632 missense probably damaging 0.99
R0310:Arid4a UTSW 12 71075830 missense probably benign 0.05
R1061:Arid4a UTSW 12 71074955 missense probably damaging 1.00
R1087:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1169:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1171:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1531:Arid4a UTSW 12 71076005 missense probably benign 0.01
R1674:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1676:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1768:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1833:Arid4a UTSW 12 71075466 missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71087589 missense probably damaging 1.00
R2290:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2292:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R3411:Arid4a UTSW 12 71061525 splice site probably benign
R3768:Arid4a UTSW 12 71067119 missense probably damaging 1.00
R3838:Arid4a UTSW 12 71075785 missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71069995 missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71069964 missense probably damaging 1.00
R4829:Arid4a UTSW 12 71023498 critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71075947 missense probably damaging 0.96
R4952:Arid4a UTSW 12 71023525 missense possibly damaging 0.64
R5072:Arid4a UTSW 12 71045079 missense probably benign 0.08
R5423:Arid4a UTSW 12 71069860 nonsense probably null
R5767:Arid4a UTSW 12 71060093 missense probably damaging 1.00
R5911:Arid4a UTSW 12 71069973 missense probably damaging 1.00
R5952:Arid4a UTSW 12 71063206 missense probably benign 0.10
R6088:Arid4a UTSW 12 71022236 missense probably damaging 0.99
R6235:Arid4a UTSW 12 71069772 intron probably null
R6277:Arid4a UTSW 12 71039891 missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71075088 missense probably benign 0.04
R6523:Arid4a UTSW 12 71067341 splice site probably null
R6701:Arid4a UTSW 12 71087512 missense probably damaging 1.00
R6812:Arid4a UTSW 12 71047263 missense possibly damaging 0.92
R6815:Arid4a UTSW 12 71017082 splice site probably null
R6837:Arid4a UTSW 12 71075515 missense probably benign
R6858:Arid4a UTSW 12 71023509 missense probably benign 0.01
R6895:Arid4a UTSW 12 71063302 missense probably benign 0.18
R6901:Arid4a UTSW 12 71067137 missense probably damaging 0.99
R6905:Arid4a UTSW 12 71061544 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GCTTGGTGTCACTTAAGAGGTGTCC -3'
(R):5'- TGGTAAACACGGAAAATACCTGATCCC -3'

Sequencing Primer
(F):5'- aaggtcgcaagttccagg -3'
(R):5'- acaaacaaacaaacaaacaaacaaac -3'
Posted On2013-06-12