Incidental Mutation 'R0504:Syne2'
ID47380
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Namespectrin repeat containing, nuclear envelope 2
Synonymssyne-2, D12Ertd777e, nesprin-2, 6820443O06Rik, Nesp2g
MMRRC Submission 038699-MU
Accession Numbers

Genbank: NM_001005510

Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R0504 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location75818134-76110926 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 76033591 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000085280] [ENSMUST00000143031]
Predicted Effect probably benign
Transcript: ENSMUST00000044217
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085280
SMART Domains Protein: ENSMUSP00000082383
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
SPEC 88 187 5.25e-1 SMART
SPEC 194 299 2.64e-4 SMART
SPEC 309 413 1.47e-2 SMART
SPEC 420 520 4.29e0 SMART
SPEC 524 632 4.47e0 SMART
low complexity region 634 654 N/A INTRINSIC
SPEC 844 942 5.7e-1 SMART
Blast:SPEC 951 1054 2e-53 BLAST
SPEC 1061 1161 2.11e0 SMART
SPEC 1168 1266 6.91e-8 SMART
SPEC 1273 1380 4.45e-11 SMART
SPEC 1387 1489 6.39e-12 SMART
SPEC 1496 1596 7.75e-11 SMART
SPEC 1823 1926 5.53e-7 SMART
SPEC 1933 2037 5.12e-2 SMART
KASH 2095 2152 8.17e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143031
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (145/147)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A G 4: 103,270,860 probably benign Het
4931440F15Rik T C 11: 29,824,990 I156V probably damaging Het
Adamts6 T C 13: 104,426,930 probably benign Het
Adamts9 T A 6: 92,912,645 Y316F probably damaging Het
Agl A T 3: 116,786,784 F374I probably damaging Het
Akr1c19 A G 13: 4,236,251 T83A possibly damaging Het
Ankrd36 T A 11: 5,629,274 S179R probably damaging Het
Appbp2 A G 11: 85,191,687 S573P probably benign Het
Arid4a T A 12: 71,047,214 F254I probably damaging Het
Asna1 A C 8: 85,018,607 V277G probably damaging Het
Bin3 T C 14: 70,123,887 probably null Het
Bmi1 T C 2: 18,684,072 probably null Het
Bmper G T 9: 23,406,687 C534F probably damaging Het
Bora T A 14: 99,061,623 C205* probably null Het
Btnl2 A G 17: 34,358,117 E82G probably benign Het
Ccdc8 A T 7: 16,996,014 D476V unknown Het
Ccr3 C A 9: 124,029,441 T271K possibly damaging Het
Cd276 A G 9: 58,540,678 L23P possibly damaging Het
Cd3e T C 9: 45,002,254 Q61R probably benign Het
Cep97 A G 16: 55,905,779 S582P probably benign Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Chst1 A G 2: 92,613,824 N214D probably benign Het
Chuk T C 19: 44,081,938 probably benign Het
Col12a1 G A 9: 79,681,468 H1122Y possibly damaging Het
Cpne6 A G 14: 55,514,602 K272R probably damaging Het
Cpsf2 T A 12: 101,990,003 L355Q probably damaging Het
Cyp2c29 T A 19: 39,309,780 D256E probably benign Het
Daglb G A 5: 143,494,197 V420I probably benign Het
Ddx42 G T 11: 106,247,849 G825C probably benign Het
Dis3 T C 14: 99,081,390 probably benign Het
Dkk4 C T 8: 22,625,343 R70C probably damaging Het
Dock6 G T 9: 21,802,436 Q1933K probably damaging Het
Dpep2 T G 8: 105,989,988 Q186H probably benign Het
Dzip3 A C 16: 48,959,643 probably benign Het
Egflam T A 15: 7,222,758 I853F probably damaging Het
Fastkd5 A G 2: 130,615,917 I251T probably benign Het
Fbn2 T A 18: 58,039,460 D2091V possibly damaging Het
Fer1l4 C A 2: 156,052,195 V63L probably benign Het
Frem1 T A 4: 82,912,637 D2062V probably benign Het
Galnt6 A C 15: 100,696,657 probably benign Het
Gm10972 A T 3: 94,643,133 probably benign Het
Gm4846 G A 1: 166,491,545 T208I probably benign Het
Gorab A G 1: 163,386,605 L252P probably damaging Het
Gtsf2 A G 15: 103,444,561 C63R probably damaging Het
Hal T C 10: 93,489,174 V15A probably damaging Het
Hmcn1 A T 1: 150,876,419 probably benign Het
Hormad2 A T 11: 4,408,833 H191Q possibly damaging Het
Hspa2 A T 12: 76,405,216 D228V probably damaging Het
Igfn1 A T 1: 135,968,529 M1433K probably benign Het
Il18 A G 9: 50,575,328 D19G probably damaging Het
Il1rl2 G A 1: 40,329,056 V129I probably benign Het
Inpp5b C A 4: 124,782,408 Y352* probably null Het
Insrr A T 3: 87,813,156 M1034L possibly damaging Het
Jmjd1c T C 10: 67,225,755 S1296P probably damaging Het
Kdm5b G T 1: 134,621,023 probably null Het
Krba1 C T 6: 48,416,254 T998I probably benign Het
L3mbtl4 A G 17: 68,777,912 N606S probably benign Het
Lonrf1 T A 8: 36,231,159 N395I possibly damaging Het
Lpp A G 16: 24,971,970 D393G probably damaging Het
Lrrc17 A G 5: 21,560,530 I3M probably benign Het
Lrrtm4 A T 6: 80,022,046 Q147L probably damaging Het
Map1a A G 2: 121,302,941 M1413V probably benign Het
Mapk8ip2 A G 15: 89,456,658 E102G possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mdn1 T C 4: 32,698,916 probably benign Het
Mfng A C 15: 78,757,314 H294Q probably benign Het
Mical2 T A 7: 112,271,317 N4K probably benign Het
Mov10l1 T A 15: 88,998,839 V384E probably damaging Het
Myo18b A G 5: 112,873,576 probably benign Het
Nlrp1b T G 11: 71,182,415 I201L probably damaging Het
Nos2 C T 11: 78,940,077 P249L probably damaging Het
Notch4 A G 17: 34,575,091 T681A probably damaging Het
Nr1i3 C T 1: 171,217,236 probably benign Het
Obscn A G 11: 59,008,507 probably null Het
Olfr1024 T A 2: 85,904,686 M123L possibly damaging Het
Olfr1230 C T 2: 89,296,739 C177Y probably damaging Het
Olfr1248 A T 2: 89,618,094 Y33N probably damaging Het
Olfr237-ps1 A T 6: 43,153,461 H52L probably benign Het
Olfr328 C A 11: 58,551,636 C201F probably damaging Het
Olfr452 C T 6: 42,790,596 R186* probably null Het
Olfr517 C T 7: 108,868,850 M101I possibly damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr705 T A 7: 106,714,701 probably benign Het
Olfr881 A G 9: 37,993,142 T217A probably benign Het
Onecut2 A T 18: 64,340,749 I124F possibly damaging Het
Otol1 G A 3: 70,027,604 G310R probably damaging Het
Oxct2b T A 4: 123,116,840 S184R possibly damaging Het
Oxct2b ACTG A 4: 123,116,912 probably benign Het
P2rx6 A G 16: 17,567,427 probably benign Het
Pde4a A G 9: 21,204,403 N411S probably damaging Het
Phkb A T 8: 86,056,524 D983V probably benign Het
Piezo2 G A 18: 63,024,451 T2396I probably damaging Het
Pik3ap1 T A 19: 41,287,490 D717V probably damaging Het
Plce1 T A 19: 38,778,021 probably benign Het
Plekhg1 A G 10: 3,937,853 I261V probably damaging Het
Ppfia4 T C 1: 134,324,113 H441R probably damaging Het
Prpf8 T A 11: 75,501,942 probably benign Het
Ptn T A 6: 36,741,453 probably benign Het
Ptpn13 A G 5: 103,501,496 Y255C possibly damaging Het
Ptpn4 A G 1: 119,765,915 Y126H probably damaging Het
Ptprc T C 1: 138,088,697 N505D probably damaging Het
Ptprs T A 17: 56,454,220 I116F possibly damaging Het
Rab1a T G 11: 20,223,169 V90G probably damaging Het
Rcor1 T C 12: 111,101,668 V267A probably benign Het
Reep4 A G 14: 70,547,238 probably null Het
Rere T A 4: 150,615,322 probably benign Het
Rin3 T A 12: 102,387,564 Y743* probably null Het
Rprm A G 2: 54,085,055 S84P probably damaging Het
Sdhaf2 C T 19: 10,517,019 E109K probably damaging Het
Sec31b G T 19: 44,534,786 Q24K probably damaging Het
Sema5a T C 15: 32,574,803 probably benign Het
Sh3pxd2a T C 19: 47,267,747 Y844C probably damaging Het
Shmt2 A C 10: 127,520,072 N134K probably damaging Het
Slc9a8 C T 2: 167,424,205 A34V probably benign Het
Spidr A C 16: 16,140,072 S64A possibly damaging Het
Stk10 A G 11: 32,617,882 T895A probably benign Het
Szt2 T C 4: 118,372,952 probably null Het
Tecpr1 A T 5: 144,214,081 V303D probably damaging Het
Tet3 A G 6: 83,373,794 Y1048H probably damaging Het
Tfb2m A G 1: 179,545,831 C101R probably damaging Het
Tg T C 15: 66,682,404 V556A probably damaging Het
Thbs4 A C 13: 92,767,184 I441M probably benign Het
Thsd7a A T 6: 12,379,594 Y944N probably damaging Het
Tm9sf3 C A 19: 41,247,892 probably benign Het
Tmem145 T C 7: 25,311,362 F359S probably damaging Het
Ttc21b C T 2: 66,222,798 probably benign Het
Ttn A G 2: 76,749,536 V23671A probably damaging Het
Txnl4b T C 8: 109,571,471 I78T probably benign Het
Ubr4 C A 4: 139,406,578 L762I probably damaging Het
Ubr4 T C 4: 139,480,838 probably null Het
Ugt1a8 C T 1: 88,088,357 P164L probably damaging Het
Unc13b T C 4: 43,263,559 S1594P probably damaging Het
Utrn A T 10: 12,402,895 F912I probably benign Het
Vat1l T C 8: 114,236,579 probably benign Het
Vmn1r50 T A 6: 90,107,881 S203T probably damaging Het
Vmn2r4 A T 3: 64,389,363 L667Q probably damaging Het
Vmn2r66 T G 7: 85,006,815 Q331P probably damaging Het
Wdsub1 A T 2: 59,878,325 V68D possibly damaging Het
Wnk2 C G 13: 49,085,394 A564P possibly damaging Het
Wnk2 T A 13: 49,085,396 K563M probably damaging Het
Zan T A 5: 137,470,318 H297L probably damaging Het
Zfp426 A T 9: 20,470,031 H539Q probably damaging Het
Zfp488 T A 14: 33,970,540 N222I probably damaging Het
Zfp536 T A 7: 37,568,818 H391L probably damaging Het
Zp1 T A 19: 10,916,207 N31I probably damaging Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76031700 unclassified probably benign
IGL00595:Syne2 APN 12 75925646 missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76064184 missense probably damaging 1.00
IGL00781:Syne2 APN 12 76024062 missense probably benign 0.00
IGL00823:Syne2 APN 12 75989242 missense probably damaging 0.98
IGL01014:Syne2 APN 12 75905277 missense probably damaging 0.99
IGL01074:Syne2 APN 12 76031587 nonsense probably null
IGL01074:Syne2 APN 12 75987011 missense probably benign 0.00
IGL01324:Syne2 APN 12 76043752 missense probably damaging 1.00
IGL01325:Syne2 APN 12 75926514 missense probably benign 0.01
IGL01331:Syne2 APN 12 75929253 splice site probably benign
IGL01338:Syne2 APN 12 76060226 missense possibly damaging 0.55
IGL01373:Syne2 APN 12 75987107 missense probably damaging 1.00
IGL01446:Syne2 APN 12 76041375 missense probably damaging 1.00
IGL01556:Syne2 APN 12 76087815 missense probably damaging 1.00
IGL01585:Syne2 APN 12 75949060 critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76004603 missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75909336 missense probably benign
IGL01935:Syne2 APN 12 75925313 missense probably damaging 1.00
IGL01941:Syne2 APN 12 75967220 missense probably benign 0.01
IGL01956:Syne2 APN 12 76097974 missense probably damaging 1.00
IGL01967:Syne2 APN 12 75941303 missense probably damaging 1.00
IGL01990:Syne2 APN 12 76054933 missense probably damaging 1.00
IGL02000:Syne2 APN 12 76015645 missense probably damaging 0.99
IGL02063:Syne2 APN 12 76052100 missense probably damaging 0.96
IGL02069:Syne2 APN 12 75927412 missense probably benign 0.13
IGL02120:Syne2 APN 12 75946706 missense probably damaging 1.00
IGL02222:Syne2 APN 12 75952843 missense probably damaging 0.96
IGL02223:Syne2 APN 12 76108305 missense probably benign 0.00
IGL02321:Syne2 APN 12 75918999 missense possibly damaging 0.58
IGL02488:Syne2 APN 12 75965738 missense probably benign 0.24
IGL02491:Syne2 APN 12 76072179 missense probably benign 0.10
IGL02525:Syne2 APN 12 76101003 missense probably damaging 0.99
IGL02578:Syne2 APN 12 76022279 missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76096994 missense probably damaging 1.00
IGL02702:Syne2 APN 12 76097924 missense probably damaging 1.00
IGL02726:Syne2 APN 12 76015582 missense probably damaging 0.99
IGL02795:Syne2 APN 12 75966549 missense probably damaging 0.99
IGL02803:Syne2 APN 12 76031546 missense probably damaging 1.00
IGL02814:Syne2 APN 12 75945376 missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75929337 missense probably benign 0.00
IGL03131:Syne2 APN 12 76057490 missense probably damaging 1.00
IGL03152:Syne2 APN 12 75965712 missense probably benign 0.12
IGL03216:Syne2 APN 12 75942961 splice site probably benign
IGL03228:Syne2 APN 12 75979912 missense probably benign 0.01
IGL03259:Syne2 APN 12 75989079 missense probably benign 0.05
IGL03374:Syne2 APN 12 76074586 missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75925435 missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75930632 missense probably benign 0.02
B5639:Syne2 UTSW 12 75929790 missense probably benign
K3955:Syne2 UTSW 12 75930665 missense probably damaging 1.00
P0026:Syne2 UTSW 12 75880220 splice site probably benign
R0089:Syne2 UTSW 12 75963876 missense probably damaging 1.00
R0110:Syne2 UTSW 12 76097960 nonsense probably null
R0113:Syne2 UTSW 12 75930578 missense probably damaging 1.00
R0113:Syne2 UTSW 12 76033722 missense probably damaging 1.00
R0141:Syne2 UTSW 12 75941298 missense probably damaging 1.00
R0211:Syne2 UTSW 12 76097957 missense probably damaging 1.00
R0219:Syne2 UTSW 12 76042004 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0279:Syne2 UTSW 12 76095613 missense probably damaging 1.00
R0319:Syne2 UTSW 12 76064162 missense probably damaging 0.99
R0325:Syne2 UTSW 12 75962641 missense probably benign 0.00
R0329:Syne2 UTSW 12 75966953 missense probably benign
R0330:Syne2 UTSW 12 75966953 missense probably benign
R0361:Syne2 UTSW 12 75918610 missense probably benign 0.22
R0363:Syne2 UTSW 12 76072207 missense probably damaging 0.98
R0367:Syne2 UTSW 12 75880177 missense probably damaging 1.00
R0371:Syne2 UTSW 12 75933845 missense probably damaging 1.00
R0374:Syne2 UTSW 12 75921226 nonsense probably null
R0388:Syne2 UTSW 12 75986975 missense probably benign 0.41
R0411:Syne2 UTSW 12 76059584 splice site probably null
R0432:Syne2 UTSW 12 75949064 missense probably damaging 0.99
R0469:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0492:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0496:Syne2 UTSW 12 76038940 missense possibly damaging 0.80
R0505:Syne2 UTSW 12 76099464 missense probably damaging 1.00
R0510:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0518:Syne2 UTSW 12 76108862 critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76024121 missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75931004 missense probably benign 0.00
R0557:Syne2 UTSW 12 75929301 missense probably benign 0.04
R0567:Syne2 UTSW 12 75890230 missense probably damaging 0.98
R0599:Syne2 UTSW 12 76097960 nonsense probably null
R0602:Syne2 UTSW 12 76097960 nonsense probably null
R0608:Syne2 UTSW 12 75963813 missense probably damaging 1.00
R0614:Syne2 UTSW 12 75912353 unclassified probably null
R0636:Syne2 UTSW 12 75930983 missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75888203 missense probably benign
R0654:Syne2 UTSW 12 76097960 nonsense probably null
R0658:Syne2 UTSW 12 76094336 missense probably damaging 1.00
R0666:Syne2 UTSW 12 75923013 missense probably damaging 0.99
R0707:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0714:Syne2 UTSW 12 76097960 nonsense probably null
R0841:Syne2 UTSW 12 76074435 splice site probably benign
R0848:Syne2 UTSW 12 76097959 frame shift probably null
R0848:Syne2 UTSW 12 76097960 nonsense probably null
R1077:Syne2 UTSW 12 76042035 missense possibly damaging 0.94
R1103:Syne2 UTSW 12 76109835 missense probably benign 0.00
R1144:Syne2 UTSW 12 75966524 missense probably benign 0.04
R1194:Syne2 UTSW 12 75934513 missense probably damaging 1.00
R1247:Syne2 UTSW 12 75967490 missense probably benign 0.39
R1276:Syne2 UTSW 12 75941189 critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76033643 missense probably damaging 1.00
R1442:Syne2 UTSW 12 75946715 missense probably damaging 1.00
R1448:Syne2 UTSW 12 76020325 splice site probably null
R1448:Syne2 UTSW 12 76052178 missense possibly damaging 0.56
R1522:Syne2 UTSW 12 76103783 missense probably damaging 0.98
R1528:Syne2 UTSW 12 75966100 missense probably benign 0.00
R1636:Syne2 UTSW 12 76004732 missense probably benign 0.01
R1637:Syne2 UTSW 12 75996002 missense probably damaging 1.00
R1650:Syne2 UTSW 12 75904259 nonsense probably null
R1654:Syne2 UTSW 12 76101094 missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76054939 missense probably benign 0.26
R1750:Syne2 UTSW 12 76052805 missense probably damaging 1.00
R1772:Syne2 UTSW 12 75938729 missense probably benign 0.19
R1797:Syne2 UTSW 12 75963783 missense probably benign 0.00
R1830:Syne2 UTSW 12 76109862 missense probably damaging 1.00
R1837:Syne2 UTSW 12 75967660 missense probably damaging 0.99
R1908:Syne2 UTSW 12 76094279 critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75899246 missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76074544 missense probably damaging 1.00
R1950:Syne2 UTSW 12 75952870 missense probably benign
R1958:Syne2 UTSW 12 75969545 missense probably benign 0.11
R2018:Syne2 UTSW 12 76074579 missense probably damaging 1.00
R2037:Syne2 UTSW 12 76025569 missense probably benign 0.04
R2067:Syne2 UTSW 12 75888342 critical splice donor site probably null
R2073:Syne2 UTSW 12 76015579 missense possibly damaging 0.54
R2099:Syne2 UTSW 12 75979973 missense probably benign 0.06
R2102:Syne2 UTSW 12 76028079 missense probably benign 0.01
R2134:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2135:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2157:Syne2 UTSW 12 76094456 missense probably damaging 1.00
R2173:Syne2 UTSW 12 76100989 splice site probably benign
R2248:Syne2 UTSW 12 76096904 missense probably damaging 1.00
R2276:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76095537 missense probably damaging 1.00
R2877:Syne2 UTSW 12 76000831 missense probably benign 0.00
R2884:Syne2 UTSW 12 75963759 missense probably benign 0.00
R3119:Syne2 UTSW 12 75909284 missense probably benign 0.01
R3499:Syne2 UTSW 12 76054978 splice site probably null
R3827:Syne2 UTSW 12 75987031 missense probably benign 0.02
R3847:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3849:Syne2 UTSW 12 76046065 nonsense probably null
R3850:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3859:Syne2 UTSW 12 75929784 missense possibly damaging 0.55
R3861:Syne2 UTSW 12 75966479 missense probably damaging 0.98
R4078:Syne2 UTSW 12 76035624 missense probably damaging 1.00
R4116:Syne2 UTSW 12 75931079 missense probably damaging 1.00
R4326:Syne2 UTSW 12 75952742 missense probably damaging 1.00
R4335:Syne2 UTSW 12 76028092 missense probably damaging 1.00
R4410:Syne2 UTSW 12 76094393 missense probably damaging 1.00
R4412:Syne2 UTSW 12 76106060 missense probably benign 0.01
R4444:Syne2 UTSW 12 76023030 missense probably damaging 1.00
R4595:Syne2 UTSW 12 75967071 missense possibly damaging 0.88
R4604:Syne2 UTSW 12 75967710 missense probably damaging 0.99
R4606:Syne2 UTSW 12 75989253 missense probably damaging 1.00
R4651:Syne2 UTSW 12 75989239 missense probably damaging 0.99
R4656:Syne2 UTSW 12 76031373 missense probably damaging 1.00
R4675:Syne2 UTSW 12 75949301 missense probably damaging 1.00
R4790:Syne2 UTSW 12 76020391 missense probably benign 0.19
R4791:Syne2 UTSW 12 75909244 missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75899167 missense probably benign 0.04
R4836:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4880:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4881:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4899:Syne2 UTSW 12 75854101 missense probably benign 0.03
R4934:Syne2 UTSW 12 75899272 missense probably benign 0.14
R4981:Syne2 UTSW 12 75941219 missense probably damaging 0.98
R4996:Syne2 UTSW 12 75943950 missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75909131 unclassified probably benign
R5066:Syne2 UTSW 12 75966551 missense probably benign 0.05
R5095:Syne2 UTSW 12 75952826 missense probably damaging 0.99
R5151:Syne2 UTSW 12 76043710 missense probably benign 0.06
R5193:Syne2 UTSW 12 76094420 missense probably damaging 1.00
R5267:Syne2 UTSW 12 75938741 missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76099338 missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76059439 missense probably damaging 0.98
R5434:Syne2 UTSW 12 75971875 missense probably damaging 1.00
R5441:Syne2 UTSW 12 75989143 missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75888172 missense probably benign 0.13
R5497:Syne2 UTSW 12 75880389 missense probably benign 0.19
R5506:Syne2 UTSW 12 75938721 missense probably benign 0.01
R5509:Syne2 UTSW 12 75921244 missense probably damaging 1.00
R5518:Syne2 UTSW 12 75945170 missense possibly damaging 0.88
R5561:Syne2 UTSW 12 76094458 nonsense probably null
R5581:Syne2 UTSW 12 75945085 missense probably benign 0.01
R5625:Syne2 UTSW 12 76095112 missense probably benign 0.06
R5642:Syne2 UTSW 12 75918532 missense probably damaging 1.00
R5665:Syne2 UTSW 12 76108217 critical splice donor site probably null
R5666:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5670:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5691:Syne2 UTSW 12 76027856 frame shift probably null
R5696:Syne2 UTSW 12 75994145 missense probably benign 0.00
R5720:Syne2 UTSW 12 75967667 missense probably benign 0.03
R5739:Syne2 UTSW 12 75997465 missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75880291 intron probably null
R5846:Syne2 UTSW 12 76028124 missense probably benign 0.01
R5850:Syne2 UTSW 12 76097975 missense probably damaging 1.00
R5889:Syne2 UTSW 12 76072252 nonsense probably null
R5912:Syne2 UTSW 12 75908947 critical splice donor site probably null
R5931:Syne2 UTSW 12 76008865 missense probably benign 0.37
R5985:Syne2 UTSW 12 75966159 missense probably damaging 0.96
R5988:Syne2 UTSW 12 75929417 critical splice donor site probably null
R5990:Syne2 UTSW 12 76024144 missense probably benign 0.10
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6132:Syne2 UTSW 12 75945147 missense probably benign 0.14
R6136:Syne2 UTSW 12 75905325 missense probably benign 0.24
R6229:Syne2 UTSW 12 75921220 missense probably benign 0.00
R6252:Syne2 UTSW 12 75969436 missense probably benign 0.39
R6271:Syne2 UTSW 12 75890381 missense probably damaging 1.00
R6320:Syne2 UTSW 12 76061650 missense probably damaging 0.96
R6339:Syne2 UTSW 12 75989153 missense probably benign 0.34
R6380:Syne2 UTSW 12 76104980 missense probably damaging 0.98
R6394:Syne2 UTSW 12 75990495 missense probably benign 0.09
R6419:Syne2 UTSW 12 76096966 missense probably damaging 1.00
R6426:Syne2 UTSW 12 75923083 missense probably null 0.97
R6434:Syne2 UTSW 12 76041456 missense probably damaging 0.99
R6437:Syne2 UTSW 12 75990414 missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75943901 missense probably damaging 0.97
R6501:Syne2 UTSW 12 76027847 unclassified probably null
R6552:Syne2 UTSW 12 75890241 missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76074447 missense probably damaging 1.00
R6810:Syne2 UTSW 12 75942885 missense probably benign 0.00
R6831:Syne2 UTSW 12 75966794 missense probably benign 0.39
R6861:Syne2 UTSW 12 75909266 missense probably damaging 1.00
R6875:Syne2 UTSW 12 76035630 missense probably damaging 0.99
R6892:Syne2 UTSW 12 75962528 missense probably damaging 0.98
R6906:Syne2 UTSW 12 75995986 missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76064195 missense probably benign 0.04
R6925:Syne2 UTSW 12 75854132 missense possibly damaging 0.58
R6949:Syne2 UTSW 12 75965997 missense probably benign 0.00
R6952:Syne2 UTSW 12 75927431 missense possibly damaging 0.76
X0019:Syne2 UTSW 12 75973287 missense probably benign 0.41
X0026:Syne2 UTSW 12 76101016 missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75927511 critical splice donor site probably null
X0066:Syne2 UTSW 12 76096927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATGTCTCAGTCATAGAGCCCTTGA -3'
(R):5'- TCCACTGTGATGCTCATACTCAGCTAA -3'

Sequencing Primer
(F):5'- TGGTCAAAAGAACTGGGGTG -3'
(R):5'- ATACTCAGCTAAGGCTCTGATGC -3'
Posted On2013-06-12