Incidental Mutation 'R3807:Gria1'
ID473943
Institutional Source Beutler Lab
Gene Symbol Gria1
Ensembl Gene ENSMUSG00000020524
Gene Nameglutamate receptor, ionotropic, AMPA1 (alpha 1)
SynonymsGlr1, Glur-1, GluRA, HIPA1, GluR1, GluR-A, 2900051M01Rik, Glur1, GluA1, Glr-1
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location57011387-57330244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57310678 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 712 (W712R)
Ref Sequence ENSEMBL: ENSMUSP00000117746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036315] [ENSMUST00000094179] [ENSMUST00000151045]
Predicted Effect probably damaging
Transcript: ENSMUST00000036315
AA Change: W781R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044494
Gene: ENSMUSG00000020524
AA Change: W781R

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 9.3e-63 PFAM
PBPe 408 783 3.65e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094179
SMART Domains Protein: ENSMUSP00000091731
Gene: ENSMUSG00000020524

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 3.7e-69 PFAM
PBPe 408 783 2.09e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151045
AA Change: W712R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117746
Gene: ENSMUSG00000020524
AA Change: W712R

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 303 4.7e-58 PFAM
PBPe 339 714 3.65e-121 SMART
Lig_chan-Glu_bd 349 414 1.65e-29 SMART
transmembrane domain 739 761 N/A INTRINSIC
low complexity region 794 805 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. This gene belongs to a family of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations in phosphorylation sites have LTD and LTP deficits and spatial learning memory defects. Null homozygotes also show stimulus-reward learning deficits and increases locomotor activity and context-dependent sensitization to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Gria1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Gria1 APN 11 57242941 nonsense probably null
IGL00807:Gria1 APN 11 57012040 missense probably benign
IGL00816:Gria1 APN 11 57317742 missense possibly damaging 0.93
IGL01110:Gria1 APN 11 57289381 missense probably damaging 1.00
IGL01116:Gria1 APN 11 57236975 missense probably damaging 1.00
IGL01120:Gria1 APN 11 57317669 missense probably damaging 0.99
IGL01843:Gria1 APN 11 57317774 missense probably damaging 1.00
IGL02135:Gria1 APN 11 57185853 missense probably damaging 1.00
IGL02308:Gria1 APN 11 57236924 missense probably benign 0.00
IGL02554:Gria1 APN 11 57289488 missense possibly damaging 0.72
IGL02813:Gria1 APN 11 57283584 missense probably damaging 1.00
IGL03071:Gria1 APN 11 57012110 unclassified probably null
IGL03326:Gria1 APN 11 57317773 missense probably damaging 1.00
PIT4445001:Gria1 UTSW 11 57185838 missense probably damaging 1.00
R0087:Gria1 UTSW 11 57317712 missense probably damaging 1.00
R0387:Gria1 UTSW 11 57309884 critical splice donor site probably null
R0399:Gria1 UTSW 11 57186027 missense probably damaging 0.97
R0502:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0503:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0549:Gria1 UTSW 11 57228973 missense probably damaging 1.00
R0590:Gria1 UTSW 11 57289409 missense probably damaging 1.00
R1377:Gria1 UTSW 11 57201176 missense probably damaging 1.00
R1395:Gria1 UTSW 11 57283566 missense probably damaging 1.00
R1422:Gria1 UTSW 11 57189788 missense probably benign 0.00
R1581:Gria1 UTSW 11 57237010 splice site probably null
R2002:Gria1 UTSW 11 57012104 missense possibly damaging 0.93
R2064:Gria1 UTSW 11 57317708 missense probably damaging 0.98
R2255:Gria1 UTSW 11 57185949 missense probably damaging 1.00
R2507:Gria1 UTSW 11 57289320 missense probably null 0.30
R2965:Gria1 UTSW 11 57185801 nonsense probably null
R3012:Gria1 UTSW 11 57289434 missense probably damaging 1.00
R3151:Gria1 UTSW 11 57283562 missense probably damaging 1.00
R5026:Gria1 UTSW 11 57310696 missense probably damaging 1.00
R5132:Gria1 UTSW 11 57289399 missense probably damaging 1.00
R5222:Gria1 UTSW 11 57189797 missense probably benign 0.22
R5303:Gria1 UTSW 11 57243025 missense probably benign 0.01
R5332:Gria1 UTSW 11 57327621 missense possibly damaging 0.93
R5413:Gria1 UTSW 11 57217794 missense probably benign 0.00
R5748:Gria1 UTSW 11 57309876 missense probably benign 0.00
R5878:Gria1 UTSW 11 57317802 critical splice donor site probably null
R5937:Gria1 UTSW 11 57189733 missense probably benign 0.00
R5995:Gria1 UTSW 11 57289285 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6180:Gria1 UTSW 11 57242792 missense probably damaging 1.00
R6187:Gria1 UTSW 11 57238110 missense possibly damaging 0.84
R6262:Gria1 UTSW 11 57242854 missense probably damaging 1.00
R6828:Gria1 UTSW 11 57289462 missense probably damaging 1.00
R7374:Gria1 UTSW 11 57189808 missense probably benign
R7507:Gria1 UTSW 11 57228939 missense probably benign 0.14
R7511:Gria1 UTSW 11 57283625 missense probably damaging 1.00
Predicted Primers
Posted On2017-04-14