Incidental Mutation 'R0504:Tg'
ID47398
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Namethyroglobulin
SynonymsTgn
MMRRC Submission 038699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0504 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location66670753-66850721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66682404 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 556 (V556A)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916]
Predicted Effect probably damaging
Transcript: ENSMUST00000065916
AA Change: V556A

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: V556A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (145/147)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A G 4: 103,270,860 probably benign Het
4931440F15Rik T C 11: 29,824,990 I156V probably damaging Het
Adamts6 T C 13: 104,426,930 probably benign Het
Adamts9 T A 6: 92,912,645 Y316F probably damaging Het
Agl A T 3: 116,786,784 F374I probably damaging Het
Akr1c19 A G 13: 4,236,251 T83A possibly damaging Het
Ankrd36 T A 11: 5,629,274 S179R probably damaging Het
Appbp2 A G 11: 85,191,687 S573P probably benign Het
Arid4a T A 12: 71,047,214 F254I probably damaging Het
Asna1 A C 8: 85,018,607 V277G probably damaging Het
Bin3 T C 14: 70,123,887 probably null Het
Bmi1 T C 2: 18,684,072 probably null Het
Bmper G T 9: 23,406,687 C534F probably damaging Het
Bora T A 14: 99,061,623 C205* probably null Het
Btnl2 A G 17: 34,358,117 E82G probably benign Het
Ccdc8 A T 7: 16,996,014 D476V unknown Het
Ccr3 C A 9: 124,029,441 T271K possibly damaging Het
Cd276 A G 9: 58,540,678 L23P possibly damaging Het
Cd3e T C 9: 45,002,254 Q61R probably benign Het
Cep97 A G 16: 55,905,779 S582P probably benign Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Chst1 A G 2: 92,613,824 N214D probably benign Het
Chuk T C 19: 44,081,938 probably benign Het
Col12a1 G A 9: 79,681,468 H1122Y possibly damaging Het
Cpne6 A G 14: 55,514,602 K272R probably damaging Het
Cpsf2 T A 12: 101,990,003 L355Q probably damaging Het
Cyp2c29 T A 19: 39,309,780 D256E probably benign Het
Daglb G A 5: 143,494,197 V420I probably benign Het
Ddx42 G T 11: 106,247,849 G825C probably benign Het
Dis3 T C 14: 99,081,390 probably benign Het
Dkk4 C T 8: 22,625,343 R70C probably damaging Het
Dock6 G T 9: 21,802,436 Q1933K probably damaging Het
Dpep2 T G 8: 105,989,988 Q186H probably benign Het
Dzip3 A C 16: 48,959,643 probably benign Het
Egflam T A 15: 7,222,758 I853F probably damaging Het
Fastkd5 A G 2: 130,615,917 I251T probably benign Het
Fbn2 T A 18: 58,039,460 D2091V possibly damaging Het
Fer1l4 C A 2: 156,052,195 V63L probably benign Het
Frem1 T A 4: 82,912,637 D2062V probably benign Het
Galnt6 A C 15: 100,696,657 probably benign Het
Gm10972 A T 3: 94,643,133 probably benign Het
Gm4846 G A 1: 166,491,545 T208I probably benign Het
Gorab A G 1: 163,386,605 L252P probably damaging Het
Gtsf2 A G 15: 103,444,561 C63R probably damaging Het
Hal T C 10: 93,489,174 V15A probably damaging Het
Hmcn1 A T 1: 150,876,419 probably benign Het
Hormad2 A T 11: 4,408,833 H191Q possibly damaging Het
Hspa2 A T 12: 76,405,216 D228V probably damaging Het
Igfn1 A T 1: 135,968,529 M1433K probably benign Het
Il18 A G 9: 50,575,328 D19G probably damaging Het
Il1rl2 G A 1: 40,329,056 V129I probably benign Het
Inpp5b C A 4: 124,782,408 Y352* probably null Het
Insrr A T 3: 87,813,156 M1034L possibly damaging Het
Jmjd1c T C 10: 67,225,755 S1296P probably damaging Het
Kdm5b G T 1: 134,621,023 probably null Het
Krba1 C T 6: 48,416,254 T998I probably benign Het
L3mbtl4 A G 17: 68,777,912 N606S probably benign Het
Lonrf1 T A 8: 36,231,159 N395I possibly damaging Het
Lpp A G 16: 24,971,970 D393G probably damaging Het
Lrrc17 A G 5: 21,560,530 I3M probably benign Het
Lrrtm4 A T 6: 80,022,046 Q147L probably damaging Het
Map1a A G 2: 121,302,941 M1413V probably benign Het
Mapk8ip2 A G 15: 89,456,658 E102G possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mdn1 T C 4: 32,698,916 probably benign Het
Mfng A C 15: 78,757,314 H294Q probably benign Het
Mical2 T A 7: 112,271,317 N4K probably benign Het
Mov10l1 T A 15: 88,998,839 V384E probably damaging Het
Myo18b A G 5: 112,873,576 probably benign Het
Nlrp1b T G 11: 71,182,415 I201L probably damaging Het
Nos2 C T 11: 78,940,077 P249L probably damaging Het
Notch4 A G 17: 34,575,091 T681A probably damaging Het
Nr1i3 C T 1: 171,217,236 probably benign Het
Obscn A G 11: 59,008,507 probably null Het
Olfr1024 T A 2: 85,904,686 M123L possibly damaging Het
Olfr1230 C T 2: 89,296,739 C177Y probably damaging Het
Olfr1248 A T 2: 89,618,094 Y33N probably damaging Het
Olfr237-ps1 A T 6: 43,153,461 H52L probably benign Het
Olfr328 C A 11: 58,551,636 C201F probably damaging Het
Olfr452 C T 6: 42,790,596 R186* probably null Het
Olfr517 C T 7: 108,868,850 M101I possibly damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr705 T A 7: 106,714,701 probably benign Het
Olfr881 A G 9: 37,993,142 T217A probably benign Het
Onecut2 A T 18: 64,340,749 I124F possibly damaging Het
Otol1 G A 3: 70,027,604 G310R probably damaging Het
Oxct2b T A 4: 123,116,840 S184R possibly damaging Het
Oxct2b ACTG A 4: 123,116,912 probably benign Het
P2rx6 A G 16: 17,567,427 probably benign Het
Pde4a A G 9: 21,204,403 N411S probably damaging Het
Phkb A T 8: 86,056,524 D983V probably benign Het
Piezo2 G A 18: 63,024,451 T2396I probably damaging Het
Pik3ap1 T A 19: 41,287,490 D717V probably damaging Het
Plce1 T A 19: 38,778,021 probably benign Het
Plekhg1 A G 10: 3,937,853 I261V probably damaging Het
Ppfia4 T C 1: 134,324,113 H441R probably damaging Het
Prpf8 T A 11: 75,501,942 probably benign Het
Ptn T A 6: 36,741,453 probably benign Het
Ptpn13 A G 5: 103,501,496 Y255C possibly damaging Het
Ptpn4 A G 1: 119,765,915 Y126H probably damaging Het
Ptprc T C 1: 138,088,697 N505D probably damaging Het
Ptprs T A 17: 56,454,220 I116F possibly damaging Het
Rab1a T G 11: 20,223,169 V90G probably damaging Het
Rcor1 T C 12: 111,101,668 V267A probably benign Het
Reep4 A G 14: 70,547,238 probably null Het
Rere T A 4: 150,615,322 probably benign Het
Rin3 T A 12: 102,387,564 Y743* probably null Het
Rprm A G 2: 54,085,055 S84P probably damaging Het
Sdhaf2 C T 19: 10,517,019 E109K probably damaging Het
Sec31b G T 19: 44,534,786 Q24K probably damaging Het
Sema5a T C 15: 32,574,803 probably benign Het
Sh3pxd2a T C 19: 47,267,747 Y844C probably damaging Het
Shmt2 A C 10: 127,520,072 N134K probably damaging Het
Slc9a8 C T 2: 167,424,205 A34V probably benign Het
Spidr A C 16: 16,140,072 S64A possibly damaging Het
Stk10 A G 11: 32,617,882 T895A probably benign Het
Syne2 A T 12: 76,033,591 probably benign Het
Szt2 T C 4: 118,372,952 probably null Het
Tecpr1 A T 5: 144,214,081 V303D probably damaging Het
Tet3 A G 6: 83,373,794 Y1048H probably damaging Het
Tfb2m A G 1: 179,545,831 C101R probably damaging Het
Thbs4 A C 13: 92,767,184 I441M probably benign Het
Thsd7a A T 6: 12,379,594 Y944N probably damaging Het
Tm9sf3 C A 19: 41,247,892 probably benign Het
Tmem145 T C 7: 25,311,362 F359S probably damaging Het
Ttc21b C T 2: 66,222,798 probably benign Het
Ttn A G 2: 76,749,536 V23671A probably damaging Het
Txnl4b T C 8: 109,571,471 I78T probably benign Het
Ubr4 C A 4: 139,406,578 L762I probably damaging Het
Ubr4 T C 4: 139,480,838 probably null Het
Ugt1a8 C T 1: 88,088,357 P164L probably damaging Het
Unc13b T C 4: 43,263,559 S1594P probably damaging Het
Utrn A T 10: 12,402,895 F912I probably benign Het
Vat1l T C 8: 114,236,579 probably benign Het
Vmn1r50 T A 6: 90,107,881 S203T probably damaging Het
Vmn2r4 A T 3: 64,389,363 L667Q probably damaging Het
Vmn2r66 T G 7: 85,006,815 Q331P probably damaging Het
Wdsub1 A T 2: 59,878,325 V68D possibly damaging Het
Wnk2 C G 13: 49,085,394 A564P possibly damaging Het
Wnk2 T A 13: 49,085,396 K563M probably damaging Het
Zan T A 5: 137,470,318 H297L probably damaging Het
Zfp426 A T 9: 20,470,031 H539Q probably damaging Het
Zfp488 T A 14: 33,970,540 N222I probably damaging Het
Zfp536 T A 7: 37,568,818 H391L probably damaging Het
Zp1 T A 19: 10,916,207 N31I probably damaging Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
also_ran UTSW 15 66678839 missense probably damaging 1.00
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
pipistrella UTSW 15 66696135 missense probably damaging 1.00
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGGAGCCCTTGGTACAAGAAGCAC -3'
(R):5'- TTCTTTGCCTCGGGAATCTACACAC -3'

Sequencing Primer
(F):5'- AACTTCAGTCAGTTTTTCCAGCAG -3'
(R):5'- TCCTCCAGCAGTGCATGATG -3'
Posted On2013-06-12