Incidental Mutation 'R0505:Lrrc37a'
ID47501
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Nameleucine rich repeat containing 37A
SynonymsLOC237954
MMRRC Submission 038700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R0505 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103451955-103504597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103503025 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 525 (S525P)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
Predicted Effect probably benign
Transcript: ENSMUST00000153273
AA Change: S525P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: S525P

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (119/121)
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,291,058 Y974H probably benign Het
Abca2 G T 2: 25,434,894 G300V probably benign Het
Abi1 A G 2: 22,962,504 probably benign Het
Actr10 T A 12: 70,959,964 Y332N probably damaging Het
Adam25 G T 8: 40,755,224 C509F probably damaging Het
Adck1 A T 12: 88,371,691 probably benign Het
Adgra3 A G 5: 50,009,334 probably null Het
Adgrl1 G T 8: 83,934,650 probably benign Het
Akr1c21 A G 13: 4,576,307 Y110C probably damaging Het
Arhgef25 T C 10: 127,183,697 I463V probably null Het
Atp6v1e2 C T 17: 86,944,578 V131M probably benign Het
Bdnf A G 2: 109,675,343 probably null Het
C7 A T 15: 4,994,142 probably benign Het
Cdc27 T C 11: 104,528,288 T273A probably benign Het
Cdo1 T A 18: 46,715,611 I187F probably benign Het
Cep104 A T 4: 153,996,304 T742S probably benign Het
Ckm A T 7: 19,419,452 K223* probably null Het
Cmtr1 C T 17: 29,676,285 P586L probably benign Het
Csmd1 C T 8: 15,992,758 R2325Q probably damaging Het
Dcpp1 A T 17: 23,882,594 I106L possibly damaging Het
Diaph3 A C 14: 87,090,964 probably benign Het
Dnah11 A G 12: 118,106,510 V1520A probably damaging Het
Dnajc25 T A 4: 59,020,438 M168K possibly damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Ebf2 A T 14: 67,371,736 K199* probably null Het
Efcab11 T A 12: 99,719,035 Q160L probably benign Het
Eif2ak4 T A 2: 118,431,036 S686T probably benign Het
Epha6 C T 16: 60,205,732 S449N possibly damaging Het
Ercc4 T C 16: 13,126,467 V329A probably benign Het
Faf1 T C 4: 109,840,403 F309L possibly damaging Het
Fam102b T C 3: 108,980,204 E248G probably benign Het
G6pd2 C A 5: 61,809,567 D228E probably benign Het
Ggt1 T G 10: 75,585,957 V546G probably damaging Het
Gm14139 T A 2: 150,193,080 C471* probably null Het
Gpatch4 G T 3: 88,051,217 V3F probably damaging Het
Gprin3 A G 6: 59,353,387 L645P probably damaging Het
Hyal2 A G 9: 107,572,071 Y342C probably benign Het
Igf2bp2 A G 16: 22,089,099 I16T possibly damaging Het
Inca1 T C 11: 70,690,199 Y61C probably damaging Het
Ipo5 T C 14: 120,942,733 W860R possibly damaging Het
Kcnj9 C T 1: 172,323,024 A341T probably benign Het
Kdm5b T C 1: 134,602,571 V440A probably damaging Het
L3mbtl1 C T 2: 162,947,335 probably benign Het
Lin54 G A 5: 100,452,293 T307I probably damaging Het
Lrrc18 C A 14: 33,009,139 Q212K probably benign Het
Lrrc71 T A 3: 87,745,699 S137C probably damaging Het
Lrrk1 A T 7: 66,290,908 probably null Het
Man2b2 G A 5: 36,816,198 S58L probably benign Het
Masp1 T A 16: 23,458,138 H539L probably benign Het
Med1 G A 11: 98,156,904 P1022L probably damaging Het
Meis1 T A 11: 19,011,360 H171L probably damaging Het
Mier1 T A 4: 103,155,623 probably benign Het
Mkl2 C T 16: 13,412,526 T1025I possibly damaging Het
Mmp13 A T 9: 7,272,929 R96S probably damaging Het
Mms19 G A 19: 41,953,734 T38I probably damaging Het
Mrc1 G A 2: 14,310,032 C976Y probably damaging Het
Naalad2 A G 9: 18,385,895 Y32H probably benign Het
Ndufs1 A G 1: 63,143,926 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Nwd2 T A 5: 63,805,111 D679E probably damaging Het
Ogdh T A 11: 6,339,936 probably benign Het
Olfm3 T A 3: 115,122,681 S421T possibly damaging Het
Olfr1281 A T 2: 111,329,328 N303I probably benign Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr559 T A 7: 102,724,029 I154F probably damaging Het
Olfr628 T C 7: 103,732,376 V150A probably benign Het
Olfr988 A G 2: 85,353,749 M59T possibly damaging Het
Opn5 T G 17: 42,592,953 T164P possibly damaging Het
Pde7b C T 10: 20,438,746 V166M probably damaging Het
Pik3ap1 T C 19: 41,324,564 N370S probably damaging Het
Pkhd1l1 A T 15: 44,589,418 D3913V probably damaging Het
Pld1 A G 3: 28,120,822 I90V possibly damaging Het
Plxna2 A G 1: 194,644,348 T197A possibly damaging Het
Plxna4 A T 6: 32,202,119 M987K probably benign Het
Pmch A G 10: 88,091,359 N75D probably benign Het
Prom2 T A 2: 127,532,867 Q583L possibly damaging Het
Pyroxd1 T A 6: 142,353,562 M148K possibly damaging Het
R3hdm2 C T 10: 127,457,700 L158F probably damaging Het
Rapgef6 A T 11: 54,625,963 T349S probably benign Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rif1 C A 2: 52,110,737 P1401Q probably damaging Het
Robo3 G A 9: 37,416,759 probably benign Het
Rpn1 T A 6: 88,090,242 S195T probably benign Het
Rslcan18 C A 13: 67,102,119 K17N probably benign Het
Rsph3b A T 17: 6,941,727 I48N probably damaging Het
Sbf2 A T 7: 110,399,343 Y628N probably damaging Het
Sis T C 3: 72,960,296 T139A probably benign Het
Slc22a14 A G 9: 119,172,034 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Smarcb1 T C 10: 75,897,066 T372A probably damaging Het
Spidr T A 16: 16,037,667 H328L probably damaging Het
Sun5 T A 2: 153,870,952 D16V probably damaging Het
Syde2 G A 3: 146,014,380 E1053K possibly damaging Het
Syne2 T C 12: 76,099,464 S6419P probably damaging Het
Tenm3 G A 8: 48,341,160 probably benign Het
Timm44 C A 8: 4,260,532 E407* probably null Het
Tmem189 A T 2: 167,644,987 probably benign Het
Tnpo2 A G 8: 85,047,362 T342A probably benign Het
Trio A G 15: 27,767,907 C1964R probably benign Het
Trip11 A C 12: 101,885,672 L711R probably damaging Het
Trp53bp1 A T 2: 121,269,969 H101Q probably damaging Het
Trpm6 A G 19: 18,873,902 probably benign Het
Ttn A T 2: 76,849,991 probably benign Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Uhrf1bp1l T C 10: 89,791,443 S145P probably damaging Het
Unc5a T A 13: 55,004,954 S838T probably damaging Het
Uxs1 T C 1: 43,764,886 probably null Het
Vmn2r108 A T 17: 20,462,834 C703S possibly damaging Het
Zc3hav1 C T 6: 38,332,664 G408R probably damaging Het
Zfp609 G A 9: 65,703,462 L740F possibly damaging Het
Zfp69 T C 4: 120,931,095 E341G probably damaging Het
Zfp707 A T 15: 75,975,256 H312L probably damaging Het
Zfp773 T C 7: 7,133,024 D191G probably benign Het
Zgrf1 C A 3: 127,573,238 D755E probably benign Het
Zscan5b T A 7: 6,239,075 I431N probably damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103500351 missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103497937 missense unknown
IGL01352:Lrrc37a APN 11 103499355 missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103498755 missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103503861 missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103504264 missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103498419 missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103456491 missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103504539 missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103497609 missense unknown
IGL02218:Lrrc37a APN 11 103500381 missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103498177 missense unknown
IGL02487:Lrrc37a APN 11 103496037 missense unknown
IGL02597:Lrrc37a APN 11 103504287 missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103499112 missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103501306 missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103491174 missense unknown
IGL02987:Lrrc37a APN 11 103500413 missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103456595 missense unknown
IGL03210:Lrrc37a APN 11 103499505 missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103499407 missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103497673 missense unknown
IGL03296:Lrrc37a APN 11 103497673 missense unknown
IGL03299:Lrrc37a APN 11 103497673 missense unknown
IGL03370:Lrrc37a APN 11 103497673 missense unknown
IGL03390:Lrrc37a APN 11 103496031 missense unknown
F5770:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103503132 missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103504512 missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103500913 missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103499790 missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103464395 missense unknown
R0418:Lrrc37a UTSW 11 103503438 missense probably benign 0.03
R0583:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103497631 missense unknown
R1581:Lrrc37a UTSW 11 103457017 nonsense probably null
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103457156 missense unknown
R1982:Lrrc37a UTSW 11 103498966 missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103501125 missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103497822 missense unknown
R2190:Lrrc37a UTSW 11 103500043 missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103497864 missense unknown
R2899:Lrrc37a UTSW 11 103497864 missense unknown
R3439:Lrrc37a UTSW 11 103497864 missense unknown
R3899:Lrrc37a UTSW 11 103497546 missense unknown
R3916:Lrrc37a UTSW 11 103455518 missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103501470 missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103457604 missense unknown
R4043:Lrrc37a UTSW 11 103498653 missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103497982 missense unknown
R4237:Lrrc37a UTSW 11 103502289 missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103464354 critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103501798 missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103498969 missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103504537 missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103504104 missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103455480 missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103504309 missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103497612 missense unknown
R4983:Lrrc37a UTSW 11 103497618 missense unknown
R4989:Lrrc37a UTSW 11 103456739 missense unknown
R5046:Lrrc37a UTSW 11 103498240 missense unknown
R5217:Lrrc37a UTSW 11 103456954 missense unknown
R5300:Lrrc37a UTSW 11 103456958 missense unknown
R5509:Lrrc37a UTSW 11 103500535 missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103498177 missense unknown
R5655:Lrrc37a UTSW 11 103498555 missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103500175 missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103458097 missense unknown
R5815:Lrrc37a UTSW 11 103503786 missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103499071 missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103500958 missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103502536 missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103456596 missense unknown
R6056:Lrrc37a UTSW 11 103497658 missense unknown
R6125:Lrrc37a UTSW 11 103501560 missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103501216 missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103497633 missense unknown
R6320:Lrrc37a UTSW 11 103504051 missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103464387 missense unknown
R6375:Lrrc37a UTSW 11 103501089 missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103497535 missense unknown
R6468:Lrrc37a UTSW 11 103460840 missense unknown
R6490:Lrrc37a UTSW 11 103456660 missense unknown
R6502:Lrrc37a UTSW 11 103492179 missense unknown
R6509:Lrrc37a UTSW 11 103504414 missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103502097 missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103500123 missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103457543 missense unknown
R7081:Lrrc37a UTSW 11 103457955 missense unknown
R7083:Lrrc37a UTSW 11 103503340 missense probably benign 0.03
V7580:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103499544 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TACTCTGAAGGATGCACCGAGGAC -3'
(R):5'- TTCCTAACTCAGCCTCCAGAGGAAG -3'

Sequencing Primer
(F):5'- CAGGTCTAACGGTAACATTTGGC -3'
(R):5'- aggaagaggaggaagaggag -3'
Posted On2013-06-12