Incidental Mutation 'R0505:Syne2'
ID47504
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Namespectrin repeat containing, nuclear envelope 2
Synonymssyne-2, D12Ertd777e, nesprin-2, 6820443O06Rik, Nesp2g
MMRRC Submission 038700-MU
Accession Numbers

Genbank: NM_001005510

Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R0505 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location75818134-76110926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76099464 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 6419 (S6419P)
Ref Sequence ENSEMBL: ENSMUSP00000119120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000085280] [ENSMUST00000126903] [ENSMUST00000143031] [ENSMUST00000154509]
Predicted Effect probably damaging
Transcript: ENSMUST00000044217
AA Change: S6418P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450
AA Change: S6418P

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085280
AA Change: S1679P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082383
Gene: ENSMUSG00000063450
AA Change: S1679P

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
SPEC 88 187 5.25e-1 SMART
SPEC 194 299 2.64e-4 SMART
SPEC 309 413 1.47e-2 SMART
SPEC 420 520 4.29e0 SMART
SPEC 524 632 4.47e0 SMART
low complexity region 634 654 N/A INTRINSIC
SPEC 844 942 5.7e-1 SMART
Blast:SPEC 951 1054 2e-53 BLAST
SPEC 1061 1161 2.11e0 SMART
SPEC 1168 1266 6.91e-8 SMART
SPEC 1273 1380 4.45e-11 SMART
SPEC 1387 1489 6.39e-12 SMART
SPEC 1496 1596 7.75e-11 SMART
SPEC 1823 1926 5.53e-7 SMART
SPEC 1933 2037 5.12e-2 SMART
KASH 2095 2152 8.17e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126903
SMART Domains Protein: ENSMUSP00000115053
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
Blast:SPEC 19 62 5e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000132161
AA Change: S415P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122781
Gene: ENSMUSG00000063450
AA Change: S415P

DomainStartEndE-ValueType
SPEC 10 117 4.45e-11 SMART
SPEC 124 226 6.39e-12 SMART
SPEC 233 333 7.75e-11 SMART
SPEC 560 663 5.53e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139204
AA Change: S1193P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118921
Gene: ENSMUSG00000063450
AA Change: S1193P

DomainStartEndE-ValueType
SPEC 39 147 4.47e0 SMART
low complexity region 149 169 N/A INTRINSIC
SPEC 359 457 5.7e-1 SMART
Blast:SPEC 466 569 3e-53 BLAST
SPEC 576 676 2.11e0 SMART
SPEC 683 781 6.91e-8 SMART
SPEC 788 895 4.45e-11 SMART
SPEC 902 1004 6.39e-12 SMART
SPEC 1011 1111 7.75e-11 SMART
SPEC 1315 1418 5.53e-7 SMART
SPEC 1425 1529 5.12e-2 SMART
KASH 1587 1644 8.17e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143031
AA Change: S6419P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450
AA Change: S6419P

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151286
Predicted Effect probably benign
Transcript: ENSMUST00000154509
SMART Domains Protein: ENSMUSP00000116718
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
SPEC 19 125 3.13e-6 SMART
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (119/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,291,058 Y974H probably benign Het
Abca2 G T 2: 25,434,894 G300V probably benign Het
Abi1 A G 2: 22,962,504 probably benign Het
Actr10 T A 12: 70,959,964 Y332N probably damaging Het
Adam25 G T 8: 40,755,224 C509F probably damaging Het
Adck1 A T 12: 88,371,691 probably benign Het
Adgra3 A G 5: 50,009,334 probably null Het
Adgrl1 G T 8: 83,934,650 probably benign Het
Akr1c21 A G 13: 4,576,307 Y110C probably damaging Het
Arhgef25 T C 10: 127,183,697 I463V probably null Het
Atp6v1e2 C T 17: 86,944,578 V131M probably benign Het
Bdnf A G 2: 109,675,343 probably null Het
C7 A T 15: 4,994,142 probably benign Het
Cdc27 T C 11: 104,528,288 T273A probably benign Het
Cdo1 T A 18: 46,715,611 I187F probably benign Het
Cep104 A T 4: 153,996,304 T742S probably benign Het
Ckm A T 7: 19,419,452 K223* probably null Het
Cmtr1 C T 17: 29,676,285 P586L probably benign Het
Csmd1 C T 8: 15,992,758 R2325Q probably damaging Het
Dcpp1 A T 17: 23,882,594 I106L possibly damaging Het
Diaph3 A C 14: 87,090,964 probably benign Het
Dnah11 A G 12: 118,106,510 V1520A probably damaging Het
Dnajc25 T A 4: 59,020,438 M168K possibly damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Ebf2 A T 14: 67,371,736 K199* probably null Het
Efcab11 T A 12: 99,719,035 Q160L probably benign Het
Eif2ak4 T A 2: 118,431,036 S686T probably benign Het
Epha6 C T 16: 60,205,732 S449N possibly damaging Het
Ercc4 T C 16: 13,126,467 V329A probably benign Het
Faf1 T C 4: 109,840,403 F309L possibly damaging Het
Fam102b T C 3: 108,980,204 E248G probably benign Het
G6pd2 C A 5: 61,809,567 D228E probably benign Het
Ggt1 T G 10: 75,585,957 V546G probably damaging Het
Gm14139 T A 2: 150,193,080 C471* probably null Het
Gpatch4 G T 3: 88,051,217 V3F probably damaging Het
Gprin3 A G 6: 59,353,387 L645P probably damaging Het
Hyal2 A G 9: 107,572,071 Y342C probably benign Het
Igf2bp2 A G 16: 22,089,099 I16T possibly damaging Het
Inca1 T C 11: 70,690,199 Y61C probably damaging Het
Ipo5 T C 14: 120,942,733 W860R possibly damaging Het
Kcnj9 C T 1: 172,323,024 A341T probably benign Het
Kdm5b T C 1: 134,602,571 V440A probably damaging Het
L3mbtl1 C T 2: 162,947,335 probably benign Het
Lin54 G A 5: 100,452,293 T307I probably damaging Het
Lrrc18 C A 14: 33,009,139 Q212K probably benign Het
Lrrc37a A G 11: 103,503,025 S525P probably benign Het
Lrrc71 T A 3: 87,745,699 S137C probably damaging Het
Lrrk1 A T 7: 66,290,908 probably null Het
Man2b2 G A 5: 36,816,198 S58L probably benign Het
Masp1 T A 16: 23,458,138 H539L probably benign Het
Med1 G A 11: 98,156,904 P1022L probably damaging Het
Meis1 T A 11: 19,011,360 H171L probably damaging Het
Mier1 T A 4: 103,155,623 probably benign Het
Mkl2 C T 16: 13,412,526 T1025I possibly damaging Het
Mmp13 A T 9: 7,272,929 R96S probably damaging Het
Mms19 G A 19: 41,953,734 T38I probably damaging Het
Mrc1 G A 2: 14,310,032 C976Y probably damaging Het
Naalad2 A G 9: 18,385,895 Y32H probably benign Het
Ndufs1 A G 1: 63,143,926 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Nwd2 T A 5: 63,805,111 D679E probably damaging Het
Ogdh T A 11: 6,339,936 probably benign Het
Olfm3 T A 3: 115,122,681 S421T possibly damaging Het
Olfr1281 A T 2: 111,329,328 N303I probably benign Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr559 T A 7: 102,724,029 I154F probably damaging Het
Olfr628 T C 7: 103,732,376 V150A probably benign Het
Olfr988 A G 2: 85,353,749 M59T possibly damaging Het
Opn5 T G 17: 42,592,953 T164P possibly damaging Het
Pde7b C T 10: 20,438,746 V166M probably damaging Het
Pik3ap1 T C 19: 41,324,564 N370S probably damaging Het
Pkhd1l1 A T 15: 44,589,418 D3913V probably damaging Het
Pld1 A G 3: 28,120,822 I90V possibly damaging Het
Plxna2 A G 1: 194,644,348 T197A possibly damaging Het
Plxna4 A T 6: 32,202,119 M987K probably benign Het
Pmch A G 10: 88,091,359 N75D probably benign Het
Prom2 T A 2: 127,532,867 Q583L possibly damaging Het
Pyroxd1 T A 6: 142,353,562 M148K possibly damaging Het
R3hdm2 C T 10: 127,457,700 L158F probably damaging Het
Rapgef6 A T 11: 54,625,963 T349S probably benign Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rif1 C A 2: 52,110,737 P1401Q probably damaging Het
Robo3 G A 9: 37,416,759 probably benign Het
Rpn1 T A 6: 88,090,242 S195T probably benign Het
Rslcan18 C A 13: 67,102,119 K17N probably benign Het
Rsph3b A T 17: 6,941,727 I48N probably damaging Het
Sbf2 A T 7: 110,399,343 Y628N probably damaging Het
Sis T C 3: 72,960,296 T139A probably benign Het
Slc22a14 A G 9: 119,172,034 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Smarcb1 T C 10: 75,897,066 T372A probably damaging Het
Spidr T A 16: 16,037,667 H328L probably damaging Het
Sun5 T A 2: 153,870,952 D16V probably damaging Het
Syde2 G A 3: 146,014,380 E1053K possibly damaging Het
Tenm3 G A 8: 48,341,160 probably benign Het
Timm44 C A 8: 4,260,532 E407* probably null Het
Tmem189 A T 2: 167,644,987 probably benign Het
Tnpo2 A G 8: 85,047,362 T342A probably benign Het
Trio A G 15: 27,767,907 C1964R probably benign Het
Trip11 A C 12: 101,885,672 L711R probably damaging Het
Trp53bp1 A T 2: 121,269,969 H101Q probably damaging Het
Trpm6 A G 19: 18,873,902 probably benign Het
Ttn A T 2: 76,849,991 probably benign Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Uhrf1bp1l T C 10: 89,791,443 S145P probably damaging Het
Unc5a T A 13: 55,004,954 S838T probably damaging Het
Uxs1 T C 1: 43,764,886 probably null Het
Vmn2r108 A T 17: 20,462,834 C703S possibly damaging Het
Zc3hav1 C T 6: 38,332,664 G408R probably damaging Het
Zfp609 G A 9: 65,703,462 L740F possibly damaging Het
Zfp69 T C 4: 120,931,095 E341G probably damaging Het
Zfp707 A T 15: 75,975,256 H312L probably damaging Het
Zfp773 T C 7: 7,133,024 D191G probably benign Het
Zgrf1 C A 3: 127,573,238 D755E probably benign Het
Zscan5b T A 7: 6,239,075 I431N probably damaging Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76031700 unclassified probably benign
IGL00595:Syne2 APN 12 75925646 missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76064184 missense probably damaging 1.00
IGL00781:Syne2 APN 12 76024062 missense probably benign 0.00
IGL00823:Syne2 APN 12 75989242 missense probably damaging 0.98
IGL01014:Syne2 APN 12 75905277 missense probably damaging 0.99
IGL01074:Syne2 APN 12 76031587 nonsense probably null
IGL01074:Syne2 APN 12 75987011 missense probably benign 0.00
IGL01324:Syne2 APN 12 76043752 missense probably damaging 1.00
IGL01325:Syne2 APN 12 75926514 missense probably benign 0.01
IGL01331:Syne2 APN 12 75929253 splice site probably benign
IGL01338:Syne2 APN 12 76060226 missense possibly damaging 0.55
IGL01373:Syne2 APN 12 75987107 missense probably damaging 1.00
IGL01446:Syne2 APN 12 76041375 missense probably damaging 1.00
IGL01556:Syne2 APN 12 76087815 missense probably damaging 1.00
IGL01585:Syne2 APN 12 75949060 critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76004603 missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75909336 missense probably benign
IGL01935:Syne2 APN 12 75925313 missense probably damaging 1.00
IGL01941:Syne2 APN 12 75967220 missense probably benign 0.01
IGL01956:Syne2 APN 12 76097974 missense probably damaging 1.00
IGL01967:Syne2 APN 12 75941303 missense probably damaging 1.00
IGL01990:Syne2 APN 12 76054933 missense probably damaging 1.00
IGL02000:Syne2 APN 12 76015645 missense probably damaging 0.99
IGL02063:Syne2 APN 12 76052100 missense probably damaging 0.96
IGL02069:Syne2 APN 12 75927412 missense probably benign 0.13
IGL02120:Syne2 APN 12 75946706 missense probably damaging 1.00
IGL02222:Syne2 APN 12 75952843 missense probably damaging 0.96
IGL02223:Syne2 APN 12 76108305 missense probably benign 0.00
IGL02321:Syne2 APN 12 75918999 missense possibly damaging 0.58
IGL02488:Syne2 APN 12 75965738 missense probably benign 0.24
IGL02491:Syne2 APN 12 76072179 missense probably benign 0.10
IGL02525:Syne2 APN 12 76101003 missense probably damaging 0.99
IGL02578:Syne2 APN 12 76022279 missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76096994 missense probably damaging 1.00
IGL02702:Syne2 APN 12 76097924 missense probably damaging 1.00
IGL02726:Syne2 APN 12 76015582 missense probably damaging 0.99
IGL02795:Syne2 APN 12 75966549 missense probably damaging 0.99
IGL02803:Syne2 APN 12 76031546 missense probably damaging 1.00
IGL02814:Syne2 APN 12 75945376 missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75929337 missense probably benign 0.00
IGL03131:Syne2 APN 12 76057490 missense probably damaging 1.00
IGL03152:Syne2 APN 12 75965712 missense probably benign 0.12
IGL03216:Syne2 APN 12 75942961 splice site probably benign
IGL03228:Syne2 APN 12 75979912 missense probably benign 0.01
IGL03259:Syne2 APN 12 75989079 missense probably benign 0.05
IGL03374:Syne2 APN 12 76074586 missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75925435 missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75930632 missense probably benign 0.02
B5639:Syne2 UTSW 12 75929790 missense probably benign
K3955:Syne2 UTSW 12 75930665 missense probably damaging 1.00
P0026:Syne2 UTSW 12 75880220 splice site probably benign
R0089:Syne2 UTSW 12 75963876 missense probably damaging 1.00
R0110:Syne2 UTSW 12 76097960 nonsense probably null
R0113:Syne2 UTSW 12 75930578 missense probably damaging 1.00
R0113:Syne2 UTSW 12 76033722 missense probably damaging 1.00
R0141:Syne2 UTSW 12 75941298 missense probably damaging 1.00
R0211:Syne2 UTSW 12 76097957 missense probably damaging 1.00
R0219:Syne2 UTSW 12 76042004 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0279:Syne2 UTSW 12 76095613 missense probably damaging 1.00
R0319:Syne2 UTSW 12 76064162 missense probably damaging 0.99
R0325:Syne2 UTSW 12 75962641 missense probably benign 0.00
R0329:Syne2 UTSW 12 75966953 missense probably benign
R0330:Syne2 UTSW 12 75966953 missense probably benign
R0361:Syne2 UTSW 12 75918610 missense probably benign 0.22
R0363:Syne2 UTSW 12 76072207 missense probably damaging 0.98
R0367:Syne2 UTSW 12 75880177 missense probably damaging 1.00
R0371:Syne2 UTSW 12 75933845 missense probably damaging 1.00
R0374:Syne2 UTSW 12 75921226 nonsense probably null
R0388:Syne2 UTSW 12 75986975 missense probably benign 0.41
R0411:Syne2 UTSW 12 76059584 splice site probably null
R0432:Syne2 UTSW 12 75949064 missense probably damaging 0.99
R0469:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0492:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0496:Syne2 UTSW 12 76038940 missense possibly damaging 0.80
R0504:Syne2 UTSW 12 76033591 splice site probably benign
R0510:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0518:Syne2 UTSW 12 76108862 critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76024121 missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75931004 missense probably benign 0.00
R0557:Syne2 UTSW 12 75929301 missense probably benign 0.04
R0567:Syne2 UTSW 12 75890230 missense probably damaging 0.98
R0599:Syne2 UTSW 12 76097960 nonsense probably null
R0602:Syne2 UTSW 12 76097960 nonsense probably null
R0608:Syne2 UTSW 12 75963813 missense probably damaging 1.00
R0614:Syne2 UTSW 12 75912353 unclassified probably null
R0636:Syne2 UTSW 12 75930983 missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75888203 missense probably benign
R0654:Syne2 UTSW 12 76097960 nonsense probably null
R0658:Syne2 UTSW 12 76094336 missense probably damaging 1.00
R0666:Syne2 UTSW 12 75923013 missense probably damaging 0.99
R0707:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0714:Syne2 UTSW 12 76097960 nonsense probably null
R0841:Syne2 UTSW 12 76074435 splice site probably benign
R0848:Syne2 UTSW 12 76097959 frame shift probably null
R0848:Syne2 UTSW 12 76097960 nonsense probably null
R1077:Syne2 UTSW 12 76042035 missense possibly damaging 0.94
R1103:Syne2 UTSW 12 76109835 missense probably benign 0.00
R1144:Syne2 UTSW 12 75966524 missense probably benign 0.04
R1194:Syne2 UTSW 12 75934513 missense probably damaging 1.00
R1247:Syne2 UTSW 12 75967490 missense probably benign 0.39
R1276:Syne2 UTSW 12 75941189 critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76033643 missense probably damaging 1.00
R1442:Syne2 UTSW 12 75946715 missense probably damaging 1.00
R1448:Syne2 UTSW 12 76020325 splice site probably null
R1448:Syne2 UTSW 12 76052178 missense possibly damaging 0.56
R1522:Syne2 UTSW 12 76103783 missense probably damaging 0.98
R1528:Syne2 UTSW 12 75966100 missense probably benign 0.00
R1636:Syne2 UTSW 12 76004732 missense probably benign 0.01
R1637:Syne2 UTSW 12 75996002 missense probably damaging 1.00
R1650:Syne2 UTSW 12 75904259 nonsense probably null
R1654:Syne2 UTSW 12 76101094 missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76054939 missense probably benign 0.26
R1750:Syne2 UTSW 12 76052805 missense probably damaging 1.00
R1772:Syne2 UTSW 12 75938729 missense probably benign 0.19
R1797:Syne2 UTSW 12 75963783 missense probably benign 0.00
R1830:Syne2 UTSW 12 76109862 missense probably damaging 1.00
R1837:Syne2 UTSW 12 75967660 missense probably damaging 0.99
R1908:Syne2 UTSW 12 76094279 critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75899246 missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76074544 missense probably damaging 1.00
R1950:Syne2 UTSW 12 75952870 missense probably benign
R1958:Syne2 UTSW 12 75969545 missense probably benign 0.11
R2018:Syne2 UTSW 12 76074579 missense probably damaging 1.00
R2037:Syne2 UTSW 12 76025569 missense probably benign 0.04
R2067:Syne2 UTSW 12 75888342 critical splice donor site probably null
R2073:Syne2 UTSW 12 76015579 missense possibly damaging 0.54
R2099:Syne2 UTSW 12 75979973 missense probably benign 0.06
R2102:Syne2 UTSW 12 76028079 missense probably benign 0.01
R2134:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2135:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2157:Syne2 UTSW 12 76094456 missense probably damaging 1.00
R2173:Syne2 UTSW 12 76100989 splice site probably benign
R2248:Syne2 UTSW 12 76096904 missense probably damaging 1.00
R2276:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76095537 missense probably damaging 1.00
R2877:Syne2 UTSW 12 76000831 missense probably benign 0.00
R2884:Syne2 UTSW 12 75963759 missense probably benign 0.00
R3119:Syne2 UTSW 12 75909284 missense probably benign 0.01
R3499:Syne2 UTSW 12 76054978 splice site probably null
R3827:Syne2 UTSW 12 75987031 missense probably benign 0.02
R3847:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3849:Syne2 UTSW 12 76046065 nonsense probably null
R3850:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3859:Syne2 UTSW 12 75929784 missense possibly damaging 0.55
R3861:Syne2 UTSW 12 75966479 missense probably damaging 0.98
R4078:Syne2 UTSW 12 76035624 missense probably damaging 1.00
R4116:Syne2 UTSW 12 75931079 missense probably damaging 1.00
R4326:Syne2 UTSW 12 75952742 missense probably damaging 1.00
R4335:Syne2 UTSW 12 76028092 missense probably damaging 1.00
R4410:Syne2 UTSW 12 76094393 missense probably damaging 1.00
R4412:Syne2 UTSW 12 76106060 missense probably benign 0.01
R4444:Syne2 UTSW 12 76023030 missense probably damaging 1.00
R4595:Syne2 UTSW 12 75967071 missense possibly damaging 0.88
R4604:Syne2 UTSW 12 75967710 missense probably damaging 0.99
R4606:Syne2 UTSW 12 75989253 missense probably damaging 1.00
R4651:Syne2 UTSW 12 75989239 missense probably damaging 0.99
R4656:Syne2 UTSW 12 76031373 missense probably damaging 1.00
R4675:Syne2 UTSW 12 75949301 missense probably damaging 1.00
R4790:Syne2 UTSW 12 76020391 missense probably benign 0.19
R4791:Syne2 UTSW 12 75909244 missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75899167 missense probably benign 0.04
R4836:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4880:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4881:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4899:Syne2 UTSW 12 75854101 missense probably benign 0.03
R4934:Syne2 UTSW 12 75899272 missense probably benign 0.14
R4981:Syne2 UTSW 12 75941219 missense probably damaging 0.98
R4996:Syne2 UTSW 12 75943950 missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75909131 unclassified probably benign
R5066:Syne2 UTSW 12 75966551 missense probably benign 0.05
R5095:Syne2 UTSW 12 75952826 missense probably damaging 0.99
R5151:Syne2 UTSW 12 76043710 missense probably benign 0.06
R5193:Syne2 UTSW 12 76094420 missense probably damaging 1.00
R5267:Syne2 UTSW 12 75938741 missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76099338 missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76059439 missense probably damaging 0.98
R5434:Syne2 UTSW 12 75971875 missense probably damaging 1.00
R5441:Syne2 UTSW 12 75989143 missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75888172 missense probably benign 0.13
R5497:Syne2 UTSW 12 75880389 missense probably benign 0.19
R5506:Syne2 UTSW 12 75938721 missense probably benign 0.01
R5509:Syne2 UTSW 12 75921244 missense probably damaging 1.00
R5518:Syne2 UTSW 12 75945170 missense possibly damaging 0.88
R5561:Syne2 UTSW 12 76094458 nonsense probably null
R5581:Syne2 UTSW 12 75945085 missense probably benign 0.01
R5625:Syne2 UTSW 12 76095112 missense probably benign 0.06
R5642:Syne2 UTSW 12 75918532 missense probably damaging 1.00
R5665:Syne2 UTSW 12 76108217 critical splice donor site probably null
R5666:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5670:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5691:Syne2 UTSW 12 76027856 frame shift probably null
R5696:Syne2 UTSW 12 75994145 missense probably benign 0.00
R5720:Syne2 UTSW 12 75967667 missense probably benign 0.03
R5739:Syne2 UTSW 12 75997465 missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75880291 intron probably null
R5846:Syne2 UTSW 12 76028124 missense probably benign 0.01
R5850:Syne2 UTSW 12 76097975 missense probably damaging 1.00
R5889:Syne2 UTSW 12 76072252 nonsense probably null
R5912:Syne2 UTSW 12 75908947 critical splice donor site probably null
R5931:Syne2 UTSW 12 76008865 missense probably benign 0.37
R5985:Syne2 UTSW 12 75966159 missense probably damaging 0.96
R5988:Syne2 UTSW 12 75929417 critical splice donor site probably null
R5990:Syne2 UTSW 12 76024144 missense probably benign 0.10
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6132:Syne2 UTSW 12 75945147 missense probably benign 0.14
R6136:Syne2 UTSW 12 75905325 missense probably benign 0.24
R6229:Syne2 UTSW 12 75921220 missense probably benign 0.00
R6252:Syne2 UTSW 12 75969436 missense probably benign 0.39
R6271:Syne2 UTSW 12 75890381 missense probably damaging 1.00
R6320:Syne2 UTSW 12 76061650 missense probably damaging 0.96
R6339:Syne2 UTSW 12 75989153 missense probably benign 0.34
R6380:Syne2 UTSW 12 76104980 missense probably damaging 0.98
R6394:Syne2 UTSW 12 75990495 missense probably benign 0.09
R6419:Syne2 UTSW 12 76096966 missense probably damaging 1.00
R6426:Syne2 UTSW 12 75923083 missense probably null 0.97
R6434:Syne2 UTSW 12 76041456 missense probably damaging 0.99
R6437:Syne2 UTSW 12 75990414 missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75943901 missense probably damaging 0.97
R6501:Syne2 UTSW 12 76027847 unclassified probably null
R6552:Syne2 UTSW 12 75890241 missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76074447 missense probably damaging 1.00
R6810:Syne2 UTSW 12 75942885 missense probably benign 0.00
R6831:Syne2 UTSW 12 75966794 missense probably benign 0.39
R6861:Syne2 UTSW 12 75909266 missense probably damaging 1.00
R6875:Syne2 UTSW 12 76035630 missense probably damaging 0.99
R6892:Syne2 UTSW 12 75962528 missense probably damaging 0.98
R6906:Syne2 UTSW 12 75995986 missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76064195 missense probably benign 0.04
R6925:Syne2 UTSW 12 75854132 missense possibly damaging 0.58
R6949:Syne2 UTSW 12 75965997 missense probably benign 0.00
R6952:Syne2 UTSW 12 75927431 missense possibly damaging 0.76
X0019:Syne2 UTSW 12 75973287 missense probably benign 0.41
X0026:Syne2 UTSW 12 76101016 missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75927511 critical splice donor site probably null
X0066:Syne2 UTSW 12 76096927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGACTTCCAAAGCTCTTTGCCAC -3'
(R):5'- GCCACATGCTGGACTCTGAATCAC -3'

Sequencing Primer
(F):5'- GCAGTAGCTTTTCAACTAGCTCAC -3'
(R):5'- CACTGAGAAATTGCTGTGTCGC -3'
Posted On2013-06-12