Incidental Mutation 'R0505:Dnah11'
ID47508
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Namedynein, axonemal, heavy chain 11
Synonymsb2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo
MMRRC Submission 038700-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R0505 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location117877982-118199043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118106510 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1520 (V1520A)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
Predicted Effect probably damaging
Transcript: ENSMUST00000084806
AA Change: V1520A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: V1520A

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (119/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,291,058 Y974H probably benign Het
Abca2 G T 2: 25,434,894 G300V probably benign Het
Abi1 A G 2: 22,962,504 probably benign Het
Actr10 T A 12: 70,959,964 Y332N probably damaging Het
Adam25 G T 8: 40,755,224 C509F probably damaging Het
Adck1 A T 12: 88,371,691 probably benign Het
Adgra3 A G 5: 50,009,334 probably null Het
Adgrl1 G T 8: 83,934,650 probably benign Het
Akr1c21 A G 13: 4,576,307 Y110C probably damaging Het
Arhgef25 T C 10: 127,183,697 I463V probably null Het
Atp6v1e2 C T 17: 86,944,578 V131M probably benign Het
Bdnf A G 2: 109,675,343 probably null Het
C7 A T 15: 4,994,142 probably benign Het
Cdc27 T C 11: 104,528,288 T273A probably benign Het
Cdo1 T A 18: 46,715,611 I187F probably benign Het
Cep104 A T 4: 153,996,304 T742S probably benign Het
Ckm A T 7: 19,419,452 K223* probably null Het
Cmtr1 C T 17: 29,676,285 P586L probably benign Het
Csmd1 C T 8: 15,992,758 R2325Q probably damaging Het
Dcpp1 A T 17: 23,882,594 I106L possibly damaging Het
Diaph3 A C 14: 87,090,964 probably benign Het
Dnajc25 T A 4: 59,020,438 M168K possibly damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Ebf2 A T 14: 67,371,736 K199* probably null Het
Efcab11 T A 12: 99,719,035 Q160L probably benign Het
Eif2ak4 T A 2: 118,431,036 S686T probably benign Het
Epha6 C T 16: 60,205,732 S449N possibly damaging Het
Ercc4 T C 16: 13,126,467 V329A probably benign Het
Faf1 T C 4: 109,840,403 F309L possibly damaging Het
Fam102b T C 3: 108,980,204 E248G probably benign Het
G6pd2 C A 5: 61,809,567 D228E probably benign Het
Ggt1 T G 10: 75,585,957 V546G probably damaging Het
Gm14139 T A 2: 150,193,080 C471* probably null Het
Gpatch4 G T 3: 88,051,217 V3F probably damaging Het
Gprin3 A G 6: 59,353,387 L645P probably damaging Het
Hyal2 A G 9: 107,572,071 Y342C probably benign Het
Igf2bp2 A G 16: 22,089,099 I16T possibly damaging Het
Inca1 T C 11: 70,690,199 Y61C probably damaging Het
Ipo5 T C 14: 120,942,733 W860R possibly damaging Het
Kcnj9 C T 1: 172,323,024 A341T probably benign Het
Kdm5b T C 1: 134,602,571 V440A probably damaging Het
L3mbtl1 C T 2: 162,947,335 probably benign Het
Lin54 G A 5: 100,452,293 T307I probably damaging Het
Lrrc18 C A 14: 33,009,139 Q212K probably benign Het
Lrrc37a A G 11: 103,503,025 S525P probably benign Het
Lrrc71 T A 3: 87,745,699 S137C probably damaging Het
Lrrk1 A T 7: 66,290,908 probably null Het
Man2b2 G A 5: 36,816,198 S58L probably benign Het
Masp1 T A 16: 23,458,138 H539L probably benign Het
Med1 G A 11: 98,156,904 P1022L probably damaging Het
Meis1 T A 11: 19,011,360 H171L probably damaging Het
Mier1 T A 4: 103,155,623 probably benign Het
Mkl2 C T 16: 13,412,526 T1025I possibly damaging Het
Mmp13 A T 9: 7,272,929 R96S probably damaging Het
Mms19 G A 19: 41,953,734 T38I probably damaging Het
Mrc1 G A 2: 14,310,032 C976Y probably damaging Het
Naalad2 A G 9: 18,385,895 Y32H probably benign Het
Ndufs1 A G 1: 63,143,926 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Nwd2 T A 5: 63,805,111 D679E probably damaging Het
Ogdh T A 11: 6,339,936 probably benign Het
Olfm3 T A 3: 115,122,681 S421T possibly damaging Het
Olfr1281 A T 2: 111,329,328 N303I probably benign Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr559 T A 7: 102,724,029 I154F probably damaging Het
Olfr628 T C 7: 103,732,376 V150A probably benign Het
Olfr988 A G 2: 85,353,749 M59T possibly damaging Het
Opn5 T G 17: 42,592,953 T164P possibly damaging Het
Pde7b C T 10: 20,438,746 V166M probably damaging Het
Pik3ap1 T C 19: 41,324,564 N370S probably damaging Het
Pkhd1l1 A T 15: 44,589,418 D3913V probably damaging Het
Pld1 A G 3: 28,120,822 I90V possibly damaging Het
Plxna2 A G 1: 194,644,348 T197A possibly damaging Het
Plxna4 A T 6: 32,202,119 M987K probably benign Het
Pmch A G 10: 88,091,359 N75D probably benign Het
Prom2 T A 2: 127,532,867 Q583L possibly damaging Het
Pyroxd1 T A 6: 142,353,562 M148K possibly damaging Het
R3hdm2 C T 10: 127,457,700 L158F probably damaging Het
Rapgef6 A T 11: 54,625,963 T349S probably benign Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rif1 C A 2: 52,110,737 P1401Q probably damaging Het
Robo3 G A 9: 37,416,759 probably benign Het
Rpn1 T A 6: 88,090,242 S195T probably benign Het
Rslcan18 C A 13: 67,102,119 K17N probably benign Het
Rsph3b A T 17: 6,941,727 I48N probably damaging Het
Sbf2 A T 7: 110,399,343 Y628N probably damaging Het
Sis T C 3: 72,960,296 T139A probably benign Het
Slc22a14 A G 9: 119,172,034 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Smarcb1 T C 10: 75,897,066 T372A probably damaging Het
Spidr T A 16: 16,037,667 H328L probably damaging Het
Sun5 T A 2: 153,870,952 D16V probably damaging Het
Syde2 G A 3: 146,014,380 E1053K possibly damaging Het
Syne2 T C 12: 76,099,464 S6419P probably damaging Het
Tenm3 G A 8: 48,341,160 probably benign Het
Timm44 C A 8: 4,260,532 E407* probably null Het
Tmem189 A T 2: 167,644,987 probably benign Het
Tnpo2 A G 8: 85,047,362 T342A probably benign Het
Trio A G 15: 27,767,907 C1964R probably benign Het
Trip11 A C 12: 101,885,672 L711R probably damaging Het
Trp53bp1 A T 2: 121,269,969 H101Q probably damaging Het
Trpm6 A G 19: 18,873,902 probably benign Het
Ttn A T 2: 76,849,991 probably benign Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Uhrf1bp1l T C 10: 89,791,443 S145P probably damaging Het
Unc5a T A 13: 55,004,954 S838T probably damaging Het
Uxs1 T C 1: 43,764,886 probably null Het
Vmn2r108 A T 17: 20,462,834 C703S possibly damaging Het
Zc3hav1 C T 6: 38,332,664 G408R probably damaging Het
Zfp609 G A 9: 65,703,462 L740F possibly damaging Het
Zfp69 T C 4: 120,931,095 E341G probably damaging Het
Zfp707 A T 15: 75,975,256 H312L probably damaging Het
Zfp773 T C 7: 7,133,024 D191G probably benign Het
Zgrf1 C A 3: 127,573,238 D755E probably benign Het
Zscan5b T A 7: 6,239,075 I431N probably damaging Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118198745 missense probably benign 0.28
IGL00422:Dnah11 APN 12 118068096 missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118036459 missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118186922 missense probably benign 0.01
IGL00687:Dnah11 APN 12 117922004 splice site probably benign
IGL00833:Dnah11 APN 12 118179580 missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117911202 missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118196651 missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118142934 splice site probably benign
IGL01121:Dnah11 APN 12 118050695 missense probably benign 0.02
IGL01143:Dnah11 APN 12 118012740 missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117982999 missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118192399 missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118047256 nonsense probably null
IGL01418:Dnah11 APN 12 117987482 nonsense probably null
IGL01444:Dnah11 APN 12 118020232 missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117983032 missense probably benign 0.15
IGL01645:Dnah11 APN 12 118186998 missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118192270 splice site probably benign
IGL02104:Dnah11 APN 12 118192390 missense probably benign
IGL02151:Dnah11 APN 12 118059888 splice site probably benign
IGL02189:Dnah11 APN 12 118082579 missense probably benign 0.00
IGL02417:Dnah11 APN 12 118057180 missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118186902 missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117975873 splice site probably benign
IGL02474:Dnah11 APN 12 118027445 splice site probably null
IGL02526:Dnah11 APN 12 118179618 missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117911040 missense probably damaging 1.00
IGL03011:Dnah11 APN 12 118012377 missense probably benign 0.08
IGL03061:Dnah11 APN 12 117903121 missense probably damaging 1.00
IGL03182:Dnah11 APN 12 118030291 missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118105985 missense probably benign
IGL03238:Dnah11 APN 12 118109898 missense probably damaging 1.00
IGL03493:Dnah11 APN 12 118012798 missense probably benign 0.00
P0045:Dnah11 UTSW 12 118030327 missense probably benign
R0009:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118126886 missense probably benign 0.05
R0172:Dnah11 UTSW 12 117987453 missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117983056 nonsense probably null
R0270:Dnah11 UTSW 12 118041013 missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118127133 missense probably benign 0.03
R0325:Dnah11 UTSW 12 118012339 missense probably benign
R0370:Dnah11 UTSW 12 117995227 missense probably benign
R0416:Dnah11 UTSW 12 117911058 missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117931178 missense probably benign 0.01
R0607:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117987469 missense probably damaging 1.00
R0635:Dnah11 UTSW 12 118007996 missense probably damaging 1.00
R0755:Dnah11 UTSW 12 117954829 missense possibly damaging 0.95
R0755:Dnah11 UTSW 12 118198625 missense probably benign 0.17
R0789:Dnah11 UTSW 12 117911232 missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0835:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0846:Dnah11 UTSW 12 117933850 missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118190844 nonsense probably null
R0928:Dnah11 UTSW 12 118045562 missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118060407 missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117933812 missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117972364 missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118057106 nonsense probably null
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1500:Dnah11 UTSW 12 118012829 synonymous probably null
R1535:Dnah11 UTSW 12 118018730 missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117931256 missense probably benign 0.01
R1554:Dnah11 UTSW 12 118082499 missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R1618:Dnah11 UTSW 12 118015465 missense probably damaging 0.98
R1638:Dnah11 UTSW 12 118015419 missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118120724 missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117933845 missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118190868 missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118196644 missense probably benign 0.32
R1728:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118190825 missense probably benign 0.31
R1780:Dnah11 UTSW 12 118027558 missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118038780 missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118063852 missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118127556 missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118082468 missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118113871 missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 118012716 missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 118020353 missense probably damaging 1.00
R2140:Dnah11 UTSW 12 118008810 missense probably benign 0.01
R2261:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2261:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2262:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2263:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117886686 missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117928330 missense probably damaging 1.00
R2410:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117987427 nonsense probably null
R3499:Dnah11 UTSW 12 117911023 missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3742:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3779:Dnah11 UTSW 12 118130713 splice site probably benign
R3785:Dnah11 UTSW 12 118017602 missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117978453 splice site probably benign
R4014:Dnah11 UTSW 12 117974914 missense probably benign 0.16
R4043:Dnah11 UTSW 12 117879943 missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118106492 missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4074:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4076:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4201:Dnah11 UTSW 12 117966659 missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118130892 missense probably benign 0.06
R4233:Dnah11 UTSW 12 117916791 missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118125843 nonsense probably null
R4430:Dnah11 UTSW 12 117983011 missense probably benign 0.26
R4465:Dnah11 UTSW 12 117987451 missense probably benign 0.09
R4489:Dnah11 UTSW 12 117916896 missense probably benign 0.31
R4572:Dnah11 UTSW 12 118010125 missense probably benign 0.00
R4574:Dnah11 UTSW 12 118012255 critical splice donor site probably null
R4657:Dnah11 UTSW 12 118192427 missense probably benign 0.02
R4709:Dnah11 UTSW 12 118018760 missense probably benign 0.26
R4740:Dnah11 UTSW 12 118120544 missense probably benign 0.28
R4803:Dnah11 UTSW 12 118127608 missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117995200 missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118126883 missense probably benign 0.37
R5018:Dnah11 UTSW 12 118130728 missense probably benign 0.00
R5071:Dnah11 UTSW 12 118082453 nonsense probably null
R5074:Dnah11 UTSW 12 118082453 nonsense probably null
R5080:Dnah11 UTSW 12 118198830 start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 118017700 missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117954751 missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118157361 missense probably benign 0.09
R5252:Dnah11 UTSW 12 118125941 missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117883416 missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118085680 missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117954893 missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118085697 missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117880451 critical splice donor site probably null
R5546:Dnah11 UTSW 12 117975848 missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 118018802 missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117883617 missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118113907 missense probably benign 0.04
R5706:Dnah11 UTSW 12 118023935 missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118127106 missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118192390 missense probably benign
R5884:Dnah11 UTSW 12 118177534 missense probably benign 0.00
R5900:Dnah11 UTSW 12 118082431 splice site probably null
R5905:Dnah11 UTSW 12 117954924 missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117914636 splice site probably null
R5973:Dnah11 UTSW 12 118110952 missense probably benign 0.02
R6024:Dnah11 UTSW 12 118030272 missense probably benign 0.34
R6056:Dnah11 UTSW 12 117928456 missense probably benign 0.03
R6075:Dnah11 UTSW 12 118104851 missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117928456 missense probably benign
R6191:Dnah11 UTSW 12 118190897 missense probably benign
R6197:Dnah11 UTSW 12 118179747 missense probably benign 0.03
R6262:Dnah11 UTSW 12 117931178 missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117916855 missense probably benign 0.01
R6614:Dnah11 UTSW 12 117886676 missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118186882 splice site probably null
R6712:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118045646 missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118113894 missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117987676 intron probably null
R6895:Dnah11 UTSW 12 117995191 missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118106562 missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118198768 missense probably benign
R6945:Dnah11 UTSW 12 118060310 missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117933809 missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118108944 missense probably benign 0.00
R6976:Dnah11 UTSW 12 118198643 missense probably benign 0.16
Z1088:Dnah11 UTSW 12 117895012 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117982969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACAGTGACAACCTTGAGC -3'
(R):5'- ATGACCCTGAGTCCCATAGGCATC -3'

Sequencing Primer
(F):5'- TGACAACCTTGAGCAGTTGATAG -3'
(R):5'- TGAGTCCCATAGGCATCCAATG -3'
Posted On2013-06-12